Abstract

Introduction: Leptospirosis, an infectious disease that can spread from animals to humans, requires the development of a safe and effective vaccine. The immunogenic characteristics of LipL41, a conserved outer membrane protein of Leptospira, have been identified as a promising vaccine candidate. In this study, a recombinant DNA construct, pTR-EGFP-LipL41, incorporating the LipL41 gene and hGMCSF adjuvant in the pTR600 vector with a cytomegalovirus (CMV) promoter, was designed and evaluated.

Methods: The Chinese hamster ovary (CHO) cell line was transfected with pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 using Lipofectamine 2000, and fluorescence microscopy analyzed their expression.

Results: The expression analysis demonstrated successful expression of pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 in CHO cells. In vitro analysis of cell lines further assessed the expression of chemokines and cytokines, and molecular docking analyses were conducted to investigate interactions between various adjuvants (hGMCSF, hIgGFc, and hC3d) and LipL41. Docking studies uncovered key interactions between LipL41 and other adjuvants. The constructed recombinant DNA and molecular adjuvants exhibited a robust immunogenic response.

Conclusion: Further evaluation in suitable animal models may establish its effectiveness as a productive and safe immunogenic molecule against leptospiral infection.

Introduction

Leptospirosis is a significant zoonotic disease caused by obligate pathogenic organisms known as gram-negative spirillates belonging to Leptospira 1, 2. The disease is an important worldwide health issue, particularly in tropical and subtropical regions, and is expected to result in over 59,000 deaths annually3. The Leptospira bacteria have numerous species, with over 300 serovars within 64 species4. This complexity has been identified as a significant challenge in combating this pathogen5. This disease is typically spread through direct contact with the tissues, urine, or other bodily fluids of infected hosts6. It can also be transmitted indirectly through contact with objects that have come into contact with infected rodents, which are the primary carriers of the bacterium. The clinical symptoms of this condition can range from mild, such as headaches, muscle pain, and fever, to severe, such as jaundice, kidney dysfunction, lung bleeding, and failure of several organs7. Therefore, it is crucial to diagnose and prevent the disease early.

Nevertheless, leptospirosis continues to be a widespread disease, and the existing vaccines are limited in terms of their accessibility. Additional doses are typically required, and the vaccines only target a small number of specific serovars to offer cross-protective protection8. The current Leptospira vaccines usually consist of whole-killed bacteria or outer membrane proteins (OMPs)9. The proliferation of numerous and varied Leptospira serovars presents difficulty in developing a vaccine that effectively covers all the serovars. The outer membrane proteins (OMPs), including LipL32, LipL41, and OmpL1, play a crucial role in the bacteria's capacity to attach to host factors and regulate immune responses10, 11, 12. These lipoproteins are significant antigens that stimulate immunological responses and can thus be utilized to develop potent vaccinations13. Among these, LipL41 holds particular significance due to its homogeneous expression throughout pathogenic Leptospira species and absence in avirulent Leptospira14. Furthermore, it has been utilized in serodiagnosis and is believed to have the potential to be integrated into vaccines15.

The utilization of DNA vaccines has ushered in a new age in vaccine development and has significantly transformed conventional practices16. DNA vaccines are referred to as third-generation vaccines due to their advantageous characteristics, including stability, simplicity, and speed in vaccine design, cost-effectiveness in production, and safety17. The vaccines mentioned above function through the direct administration of plasmid DNA that contains the genetic code for the desired antigen18. This genetic material is subsequently produced within cells, triggering immunological responses. Mammalian expression systems are frequently utilized for DNA vaccines due to their ability to undergo post-translational modifications and efficiently process proteins, mimicking the conditions of the host organism19. DNA vaccines for leptospirosis have developed extensively, notably pTarget/LipL32, which has demonstrated the ability to elicit humoral immune responses and recognize native L. interrogans membrane proteins15. Lately, there has been a discussion on how molecular adjuvants can enhance the effectiveness of vaccines. Studies have shown that adjuvants, including hGMCSF (human granulocyte-macrophage colony-stimulating factor), stimulate the innate immune system, guide cell mobility, and enhance the collaboration of immune cells in presenting antigens20. DNA vaccines contain elements of these adjuvants. Multiple experiments have proven that molecular adjuvants can improve DNA vaccines' immunogenicity and stimulate cytokine production and antigen processing under specific conditions21.

Therefore, in this investigation, we chose to utilize a mammalian expression system to express the LipL41 ORF of the Leptospira and the EGFP and hGMCSF. The recombinant DNA was introduced into Chinese Hamster Ovary (CHO) cells because of their widespread use in protein manufacturing, as they reliably replicate the desired quantities22. The cells were transfected using Lipofectamine 2000 and calcium phosphate techniques, and the expression of the constructs containing the EGFP was verified using fluorescence microscopy. The immunological response to the recombinant DNA constructs was assessed by analyzing the production of cytokines and chemokines following transfection. Furthermore, protein-protein docking was conducted to determine the interaction between LipL41 and molecular adjuvants (hGMCSF, hIgGFC, and hC3d), demonstrating that hGMCSF is the most effective adjuvant for enhancing the vaccination potential of the peptide. Considering the data collected from the docking experiments and the expression data of hGMCSF in CHO cells, LipL41, when used as a heterologous DNA vaccine with hGMCSF, shows potential as a candidate for a leptospirosis vaccine. This work marks the beginning of developing second-generation leptospira vaccines that target many Leptospira serovars. This study further emphasizes the importance of investigating molecular adjuvants and DNA vaccine technologies and the integral role of the scientific community in creating necessary preventive methods against leptospirosis.

Methods

E. coli XL10 was used to generate and transform all recombinant plasmids. The sequences of all cloned PCR-amplified products were confirmed by sequencing. Sambrook's protocols for cloning and isolating plasmid DNA were used23. Hi-Media Labs provided all the chemicals, reagents, and antibiotics (India). Thermo Fisher Scientific supplied molecular biology reagents, the pTZ57R/T vector, and restriction endonucleases (USA). E. coli XL10 were grown in LB buffer containing the requisite concentrations of antibiotics for selective growth (Sigma-Aldrich, USA). We utilized molecular-grade water (Hi-Media, India) and phosphate-buffered saline (PBS) for all cloning and cell culture procedures. The cell culture media, Roswell Park Memorial Institute (RPMI), along with 10% fetal bovine serum (FBS) and antibiotics, were procured from Hi-Media (India). Calcium phosphate was obtained from Sigma-Aldrich (USA) for experimental use. The National Centre for Cell Science (NCCS) provided the CHO cell line.

Molecular Modeling and Docking

The sequence of LipL41 was retrieved from UniProt (www.uniprot.org) with the UniProt ID: Q33BM7, comprising 355 residues. A sequence similarity search for the target sequence was conducted using the Protein Data Bank on the BLAST server24. The Modeller software (version 9.9) was utilized to generate the structural model of the LipL41 protein25. Following prediction, the generated structure was saved in PDB format, and scores were calculated based on Discrete Optimized Protein Energy (DOPE)26. Standard programs evaluated the quality of the optimized model27, 28, 29. The final optimized structural model and spiral model were used for further analysis. Three significant glycoproteins or molecular adjuvants (hC3d, GMCSF, and hIgGFC) were employed to evaluate the binding effectiveness of the LipL41 protein. ClusPro 2.0 was used to investigate the potency of LipL41's interactions with molecular adjuvants30.

Construction of pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 Plasmid

The EGFP (Enhanced Green Fluorescent Protein) gene, generously provided by Dr. B. Ashok Kumar from Madurai Kamaraj University, India, was amplified from the pEGFP plasmid. Furthermore, the study utilized the hGMCSF (human Granulocyte-Macrophage Colony-Stimulating Factor) gene, which was graciously provided by Dr. Tracy Willson from The Walter and Eliza Hall Institute of Medical Research, Australia. The transcription of these two genes (EGFP and hGMCSF) was achieved by using pairs of gene-specific primers flanked by a recognition sequence for a restriction enzyme, together with normal PCR conditions. Following electrophoresis on a 0.8% agarose gel, the PCR products underwent purification before being ligated into the pTZ57R/T vector. The resulting ligation mixture was then introduced into E. coli XL10 competent cells. Subsequently, colony PCR was employed to verify the identity of the selected recombinant colonies.

The recombinant DNA was processed using restriction enzyme-bounded primers, and the 1% agarose gel electrophoresis revealed 1056 bp of LipL41, 717 bp of EGFP, and 453 bp of the hGMCSF gene release. The recombinant clones (pTZ-LipL41, pTZ-EGFP, and pTZ-hGMCSF) were sub-cloned into the pTR600 mammalian expression vector (a kind gift from Dr. Ted Ross, University of Pittsburgh, USA), which was constructed to carry the cytomegalovirus (CMV). The recombinant DNA constructs were named pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41. Finally, the recombinant plasmids were extracted using the alkaline lysis method and were purified with a 30 mM concentration of MgCl2 and different concentrations of polyethylene glycol (PEG) 40% and PEG 6000. Afterwards, the purified plasmids were dissolved using molecular-grade water. Finally, the recombinant plasmids were transfected into the CHO cell line for EGFP expression.

Cell Viability

The CHO cell line was cultured in RPMI medium and seeded into cell culture flasks. These flasks were then placed in an incubator set at 37°C with a 5% CO2 atmosphere for 12 hours. Following incubation, adherent cells were observed using an inverted microscope. Subsequently, the adherent cells were rinsed with 1% trypsin solution and centrifuged at 600 rpm for 5 minutes. The Trypan Blue dye exclusion test determines the number of viable cells in a cell suspension. The cells were counted using a hemocytometer under the light microscope (100X). The following equation determined the number of viable cells: percentage of viable cells (cells/ml) = (average number of cells in 4 quadrants) x dilution factor for the size of the quadrant (i.e., 10,000) x dilution factor for the addition of trypan blue. Finally, 5 x 105 cells per well were added into 6-well plates (35 mm2). The total number of cells within the flask was determined using the following equation: Total cells in the flask = cells/ml x mL.

Lipofectamine-Mediated Transient EGFP Expression

The recombinant DNA constructs pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 were introduced into the CHO cell line through transfection. The CHO cell lines were cultured in RPMI media, both complete and incomplete, supplemented with 10% FBS and a penicillin-streptomycin antibiotic solution (Hi-Media, India). The cell cultures were maintained at 37°C in a humidified atmosphere with 5% CO2 concentration.

In Vitro DNA Transfection in CHO Cell Line

The CHO cells were cultured by seeding 5 x 105 cells into 6-well plates (35 mm2), and the plates were incubated at 37°C and 5% CO2 overnight. The CHO cells were transfected with DNA constructs pTR600, pTR-EGFP-LipL41, and pTR-EGFP-hGMCSF-LipL41 using Lipofectamine™ 2000. Briefly, the supernatant 10-15 µL with five µg of plasmid DNA was mixed with RPMI media (Tube A). Tube marked as B has 5μL of Lipofectamine™ 2000 reagent. The contents of tubes A & B were mixed and kept at 37°C for 30 minutes. Subsequently, 1.5 mL of reduced serum media was added to each well, and the master mix (~400μL) was added to each well of 6-well plates (35 mm2). The plates were incubated for 72 hours, performed in triplicate, and repeated twice.

Cytotoxicity Assay

The cytotoxicity assay was employed on pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41. In summary, CHO cells (5 x 105) were subjected to treatment with Lipofectamine 2000 at concentrations of 2.5, 5, 7.5, and 10, and then incubated in the dark for 12 hours. Tests were run in triplicates, and sample sizes (positive and negative controls) were developed. The positive control wells contained Lipofectamine transfect plasmid DNA (pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41), while the negative control wells contained the same number of CHO cells and the pTR600 vector without EGFP. The mixture was incubated for hours at 37°C in a CO2 incubator with a CO2 concentration of 5%. The RPMI growth medium was withdrawn after incubation, and 100 mL of growth medium was added with various doses of plasmid DNA pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 (1-10 mg/mL) and maintained for 12 hours at 37°C in a humidified incubator with 5% CO2. After incubation, the culture media was withdrawn correctly, and 150 μL of MTT was added to each well. MTT cultures were maintained for 3 hours at 37°C in a humidified incubator with a CO2 concentration of 5%. The proportion of viable cells was calculated using the formula: % viability of cells = (OD of test / OD of control) x 100.

Fluorescent Microscopic Analysis

Transfected CHO cells were washed with phosphate-buffered saline (PBS). Washed cells were carefully placed on a glass slide, and the periphery was sealed with nail paint. Mounted slides were observed under the fluorescence microscope. Protein expression (GFP tagged) was checked by fluorescent and confocal microscopy.

Real-Time PCR

The pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 were transfected into the CHO cell line using Lipofectamine™ 2000. The cells that received the genetic material were cultured for 24 hours at a temperature of 37°C in a CO2 incubator with a CO2 concentration of 5%. After incubation, RNA isolation was carried out using the Hi-PurA™ Total RNA Miniprep Purification Kit, and cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). A Nanodrop analyzer checked the concentration of cDNA. The 100 ng of cDNA was used to study cytokine and chemokine expression using specific primers. The samples underwent amplification using 20 µL of cDNA, including forward and reverse primers, along with 1X SYBR Green I Master mix (Roche) and molecular-grade water. The PCR cycle consisted of denaturation at 25°C for 10 minutes, annealing at 42°C for 30 minutes, and extension at 85°C for 5 minutes. Details of the RT-PCR primers are provided in Table 1.

Table 1.

RT-PCR primers used in this study

Cytokines Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’) IL-2 AATTCGGTACATCCTCACGG GGTTGTTTTCTGCCAGTGCC IL-6 AATTCGGTACATCCTCGACGG GGTTGTTTTCTGCCAGTGCC IL-8 GACCACACTGCGCCAACAC CTTCTCCACAACCCTCTGCAC IL-10 GGTTGCCAAGCCTTGTCTGA AGGGAGTTCACATGCGCCT TNF α GGAGAAGGGTGACCGACTCA CTGCCCAGACTCGGCAA IFN γ AGCTCTGCATCGTTTTGGGT CGCTTCCCTGTTTTAGCTGC CXCL11 CCTTGGCTGTGATATTGTGTGCTA CCTATGCAAAGACTGCGTCCTC CCL17 TGAGGACGCTCCAGGGATG AACGGTGGACGTCCCAGGTA β- ACTIN TCACCCACACTGTGCCCATCTACG CAGCGGAACCGCTCATTGCCAATG

Table 2.

Protein-Protein docking of LipL42 against three Molecular Adjuvants

Protein 1 Protein 2 PDB ID of Protein 2 Resolution (Å) Interaction Energy (Kcal/mol)