In silico TCGA data analysis

The web-based cancer genomics resource database CBioPortal (https://www.cbioportal.org, accessed on 25th August 2023) was used to gather data regarding the mRNA expression levels of ITGB6 in patients afflicted with OSCC [30, 31]. The Head and Neck Squamous Cell Carcinoma TCGA Firehouse Legacy data set, comprising 530 tumor samples, was utilized. By limiting the analysis to samples with the designation “Primary tumor” for sample type, available T-stage, and the primary tumor sites “Oral Tongue”, “Oral Cavity”, “Floor of mouth”, “Base of tongue”, “Buccal Mucosa”, “Alveolar Ridge”, “Hard Palate”, and “Lip” in order to select OSCC for our focus, the number of samples an patients was reduced to 335. The expression levels of mRNA were normalized to z-scores relative to diploid samples (RNA Seq V2 RSEM). Two groups were built (1st and 4th quartile) based on the ITGB6 mRNA expression levels (low expression z-score: -1.04 - -0.64; high expression z-score: 0.46–6.39). The total number of patients included in the study patients decreased to 165 (82 in group “low expression”, 83 in group “high expression”).

Cell culture

The used OSCC cell line “HN” was gained from a lymph node metastasis of a moderately differentiated squamous cell carcinoma of the soft palate (DMSZ; ACC 417). The derivation of the cell line from a metastatic cancer is of great importance in evaluating the impact of ITGB6 on the metastatic potential. The cells were maintained in Dulbecco´s Modified Eagle´s Medium (DMEM) (Sigma Aldrich, St. Louis, Missouri, USA) supplemented with 10% (v/v) fetal calf serum (FCS) (Sigma Aldrich, St. Louis, Missouri, USA) and cultured in accordance with previously described methodology [32].

Genome editing using CRISPR/Cas9

For detailed information on the protocol, exact amounts of applied components and the entire workflow, please refer to Geyer et al. [32].

Gene editing was performed using RNPs (ribonucleoprotein complexes) containing a gRNA and Cas9 protein, transfected by lipofection. In this study the guide sequence “gRNA1” (GCTAATATTGACACACCCGA) on genomic position Chr2. 160,174,011, targeting the human ITGB6 locus on chromosome 2 with a positioning of the Cas9 cut site on the fifth exon, was used. The sgRNA was assembled by heating up equimolar amounts of the guide sequence (Alt-R CRISPR/Cas9 crRNA; IDT, Coralville, Iowa, USA) and Alt-R CRISPR/Cas9 tracrRNA (IDT, Coralville, Iowa, USA) for 5 min at 95 °C. Overall, for each well (24-well format) 480 ng gRNA and 250 ng Cas9 protein were used for lipofection.

24 h prior to transfection, 50,000 cells were seeded per well on a 24-well-plate, in order to achieve a confluency of 50–60% at the time of transfection. Transfection was conducted in a 24-well format using Lipofectamine CRISPRMAX (Invitrogen, Waltham, USA) for a period of 48 h. For the complete RNP assembly, TrueCut Cas9 v2 (Thermofisher, Waltham, MA, USA) was employed. DNA isolation was performed directly from cells, using the Phire Tissue PCR Master Mix (Thermofisher) in the “Dilution and storage protocol” according to the manufacturers’ protocol. Thereof 1 µl was used for amplification of genomic DNA by PCR prior to sequencing. Two flanking primers were designed (fwd: 5`-GTTGCAGAGTCAGGCCCTTTAG-3`; rev: 5`-GGACAGTCCCCATTTCAACATG-3`) to obtain amplicons of about 500 bp (250 bp up- and downstream of the Cas9 cut site) for Sanger sequencing. PCR was performed according to the “Phire Tissue PCR Master Mix” (Thermofisher) manufacturers protocol. For details on the cycling conditions, please refer to Geyer et al. [32].

DNA purification was conducted using the qiaQuick DNA purification Kit (Qiagen, Hilden, Germany), in accordance with the suggested Kit protocol. The purified PCR products were then subjected to sequencing at Eurofins Genomics (Ebersberg, Germany) at a minimum concentration of 5 ng/µl. The forward PCR primer was used as the sequencing primer. Sequence analysis was done with ICE (Synthego, Redwood City, USA; https://ice.synthego.com) [33].

Isolation of a monoclonal knockout cell clone

For the isolation of ITGB6 KO cell clones derived from a single cell, limiting dilution was used. For this, cells were counted and diluted in cell culture medium to a concentration of 5 cells / 1 ml. Subsequently, 100 µl of the solution were added to each well of a 96-well plate, resulting in a concentration of 0.5 cells per well. The plates were incubated at 37 °C and 5% (v/v) CO2 for 4 to 7 days. At this point, the first colonies could be identified under the microscope (100 x magnification). Wells with more than one colony were discarded. The remaining wells were then further cultured under the given conditions. For analysis of the clones, please refer to the aforementioned steps.

Analysis of protein expression using flow cytofluorometry

Cells were stained for ITGB6 by using standard procedures for flow cytometry.

For this, cells were incubated for 10 min with a Fc receptor-blocking antibody (BD Biosciences, Heidelberg, Germany) and iFlour 840 maleimide live-dead stain (AAT Bioquest, Pleasanton, CA,

USA). Subsequently the cells were stained with an APC-labeled anti-ITGB6 antibody (Miltenyi Biotec, Bergisch Gladbach, Germany; Catalog#: 130-111-454) for 30 min in phosphate-buffered saline (PBS) supplemented with 2% (v/v) FCS and 2 mM EDTA. Analysis was performed using a Cytoflex LX flow cytometer (Beckman Coulter, Brea, CA, USA).

MTT proliferation assay

The extent of cell proliferation was quantified using the (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay [34]. For this purpose, HN cells were plated at a density of 4,000 cells/100 µl/96-well and cultured for 24 h.

Prior to spectrophotometric measurement at day one to five, 20 µl of MTT (5 mg/ml) were added to each well and incubated for 2.5 h at 37 °C and 5% (v/v) CO2. Subsequently, the solution of culture medium and MTT was carefully aspirated, and 100 µl DSMO added to each well.

The 96-well cell culture plates were then gently agitated in order to completely dissolve all blue formazan crystals. By use of a Multiskan™ Fc photometer (Thermo Fisher Scientific, Waltham, USA), the absorbance of the solution was spectrophotometrically determined at 570 nm as measure of cell numbers. Measurements were done in triplicate and in three independent experiments.

Wound scratch assay

The migratory activity of cells was analyzed by wound scratch assays.

For this, 100,000 cells/well were seeded in 800 µl FCS-free cell culture medium on 24-well cell culture plates in order to minimize the effects of proliferation over migration and incubated for 24 h. The culture medium was then aspirated and a wound scratch set by use of a 200 µL pipette tip. Thereafter, cells were washed thoroughly in PBS and fresh FCS-free cell culture medium was added. Microscopic images (Zeiss, Oberkochen, Germany) were taken directly after wounding the cell monolayers (start) as well as after every other 4 h until the wound gap closure was visible. The extent of wound gap closure over time was analyzed by ImageJ (https://imagej.nih.gov/ij) using the “Wound Healing Size Tool”, established by Suarez-Arnedo et al. [35].

Statistical analysis

Each experiment was repeated at least three times and was carried out in triplicate. The data were expressed as mean ± SD. Overall survival was analyzed using the Kaplan-Meier method and survival difference was compared by log-rank test. Statistical analysis was conducted using GraphPad Prism (Version 9.5.1). The differences between two groups were determined by Student´s t test, and the differences among multiple groups were determined by one-way Anova. The clinical outcome parameters were compared using the Chi-Squared test. The time from diagnosis to death by any cause was defined as OAS. The results were assumed to be significant if p < 0.05.