記住我
Human umbilical cord mesenchymal stem cells (hUMSCs), derived from Wharton’s Jelly in human umbilical cord, have many advantages including multidirectional differentiation potential, low immunogenicity no ethical controversies, and vastly available source.[1,2] hUMSCs can differentiate into various types of cells, such as osteoblasts, adipocytes, chondrocytes, islet cells, nerve cells, cardiomyocytes, hepatocytes, germ cells, and so on. In recent years, hUMSCs have been used for treatment of a variety of disease, such as chronic liver injury[3] and renal failure.[4] However, apoptosis, low differentiation rate and low migration rate to damaged organs of transplanted cells limit the further application of hUMSCs. Therefore, improving the migration and differentiation ability, inhibiting apoptosis of transplanted cells might increase the efficacy of hUMSCs transplantation.
The modern pharmacological studies have demonstrated that the effective components and extracts of Chinese Herbs, including Epimedii, Naringin, Loganin, Morroniside, Epimedium flavonoids, Dodder flavonoids, Morinda root polysaccharides have extensive physiological activity and novel pharmacological effects on increasing the multipotency of hUMSCs.[5] Icariin (ICA), the main active ingredient of Epimedii, has many biological effects, including improving cardiovascular function, hormone regulation, immunological function modulation, and antitumor activity.[6,7]Oct-4, one of the pluripotent gene, was significantly up-regulated after 1 week ICA (100 μmol/L) treatment in mice in an acute kidney injury model in vivo.[8] ICA-treated hUMSCs were remarkably increased the accumulation and migration to damaged tissue after transplantation, which had an increasing paracrine effect on damage tissue.[9,10] However, the reason why ICA could improve the tissue-repairing function and the migration rate of transplanted hUMSCs remains unknown.
Circular RNAs (circRNAs) are a special class of noncoding RNA molecules, accounting for 95% of the total RNA of eukaryotic cells. CircRNAs derived from certain pre-mRNA through circularization of exon and intron during gene splicing, forming a single-stranded covalently closed circular structure without 5’-3’ polarity nor a polyadenylated tail.[11,12] Studies have shown that circRNAs are involved in various biological processes and play an important role in the occurrence and development of complex diseases. Therefore, identifying the association between circRNAs and diseases will contribute to the diagnosis and treatment of diseases.[11,13] In recent years, cumulative studies have focused on the potential underlying RNA-mediated biological processes or gene regulation. CircRNAs could regulate the transcription and gene splicing process and affect the RNA binding protein.[14] Moreover, circRNAs could serve as microRNA (miRNA) sponges to regulate the function of miRNA.[15] Antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as) is one of the circRNAs that have at least 60 conserved binding sites to miRNA-7 (miR-7).[16,17] CDR1as could down-regulate miR-7 expression, over-expression of CDR1as in zebrafish could decrease the volume of brain.[18,19] CircFoxo3 could bind to cell division protein kinase 2 to form a ternary complex, resulting in repressing cell cycle progression.[19,20]
Considering the accumulative evidence about the role of circRNAs in regulating biological processes, we further focused on the circRNAs changes in hUMSCs after ICA treatment in an effort to identify the possible epigenetic mechanisms of ICA inducing the tissue repairing function and migration ability of hUMSCs. In this study, differentially expressed circRNAs in hUMSCs after ICA treatment were screened.
2. Material and methods 2.1. Ethics approvalThis study has been approved by the ethic committee of Tianjin University of Traditional Chinese Medicine (SYXK2012–0015), and all methods were carried out in accordance with the relevant guidelines and regulations.
2.2. ReagentICA standard substance (purity: >98%; National Institute for Control of Pharmaceutical and Biology Product, Beijing, China); DMEM/F12, fetal bovine serum (FBS), and PBS solution (Hyclone, Logan, UT); penicillin and streptomycin (PS) and l-glutamine (LG, Solarbio, Beijing, China).
2.3. Cell cultureThe isolation of hUMSCs was conducted as previously described.[19] In detail, human umbilical cord was obtained from a healthy donor (upon obtaining informed patient consent), which was immediately transferred to the laboratory. Under class III laminar-flow hood, the cord was exposed to Wharton’s Jelly tissue and cut into 1 mm3 fragments. Then, they were immersed in 15 mL culture medium (supplemented with 10% FBS, 1% PS, and 1% LG) in T75 tissue culture flasks. The tissue culture flasks were placed in an incubator with saturated humidity at 37°C containing 5% CO2. Fibroblast-like cells started to migrate out of the tissue pieces after 7 days. They proliferated and were sub-cultured up to passage 4 in which homogenous cell populations were obtained.
2.4. Inducement of hUMSCs with ICAThe hUMSCs were sub-cultured in 15 mL culture medium (supplemented with 10% FBS, 1% PS, and 1% LG) in T75 tissue culture flasks. One week before hUMSCs were administered, the expansion medium was changed to ICA containing medium (supplemented with 100 μmol/L of ICA, 10% FBS, 1% PS, and 1% LG) and cultured for 1 week with the medium being changed every 3 days. As a control, normal hUMSCs were cultured in similar culture medium that was changed every 3 days. Detailed information of ICA was obtained according from the NCBI PubChem.
2.5. Total RNA extraction, circRNAs library construction, and sequencingTotal RNA was isolated from hUMSCs samples using Trizol reagent according to the manufacturer’s instructions. RNA quantification and quality were assessed by a NanoDrop ND-1000. For spectrophotometry, the O.D. A260/A280 ratio should be near 2.0 for pure RNA (ratios between 1.8 and 2.1 are acceptable). The O.D.A260/A230 ratio should be more than 1.8. RNA integrity and DNA contamination were tested by denaturing agarose gel electrophoresis. DNA should be completely absent, and RNA should not be degraded. RNA integrity meets the requirements when ≥7. The sequencing library was determined by Agilent 2100 system.
2.6. Identification of differentially expressed circRNAsAfter normalization of the raw reads, circRNAs belonging to at least 2 samples were chosen for further data analysis. Using the normalized number of reads, significantly differentially expressed circRNAs were identified through volcano plot filtering. Hierarchical clustering was performed using Heatmap2 in software R, and circRNAs with a fold change more than 2.0, P value of <.05, and false discovery rate <0.05 were filtered.
2.7. Quantitative real-time polymerase chain reactionTo validate the accuracy of the circRNAs-seq data, quantitative real-time polymerase chain reaction (qRT-PCR) was performed as a confirmatory method. cDNA of the tumor and normal samples was synthesized by reverse transcription using a Primescipt RT reagent kit with gRNA Eraser according to manufacturer’s protocols (TaKaRa, Japan). The differentially expressed circRNAs were measured by qRT-PCR using SYBR premix ExTaq (TaKaRa, Japan) on Applied Biosystems StepOnePlus Real-Time PCR system. The primers of randomly selected 12-pair outward-facing circRNAs are shown in Table 1. The qRT-PCR condition was set at an initial denaturation step of 10 min at 95°C and 95°C for 10 seconds, 60°C for 60 seconds, 95°C for 10 seconds for a total of 40 cycles, with a final step heating slowly from 60°C to 99°C. The relative expression of each circRNA was calculated relative to GAPDH and the expression levels of these circRNAs were calculated as 2−∆∆CT.
Table 1 - The primers of randomly selected 12-pair outward-facing circRNAs. Gene symbol Primer sequence (5′-3′) UHRF2 F: TTGCTGCTGATGAAGACGTT R: GGTCTGGGCGAACTAGCA RNF13 F: TGGGCATCTGTCTCATCTTG R: TGACAGCATGAGCATCCC NADK2 F: AGGACCCCAACTTCTGCC R: CCTCAATTCCCTCATTCCG LOC401320 F: CGCTGGTGTCTGTCCTCC R: GGGGTGACCTGGTTGTGA PSD3 F: TCCATTGCCTTACCTGTGC R: GGCTGCTTCCACATTGCT TBC1D1 F: AGCAGCCAAAGGATGTGC R: AGGAGATCGTGGGGGAAG SMO F: GCTCATCGTGGGAGGCTA R: GGGTTCTGGCACTGGATG TRIO F: CTGGCTCAGACTGGGGAA R: TGGCTGGTCCCAATCTCT RP11-632K20.7 F: AGAAATACTGCTTACTACACA R: CTAATTCCTGGTAGGCTTC GLIS3 F: GGAGTTTGGAAGCCCTTTTC R: GATGTCCGGTGGAGACTCAT PTK2 F: GATATGGGCGTCTCCAGTGT R: GCAGCTGCCATTATTTTGCT GAPDH F: AAGGTCATCCCAGAGCTGAA R: CTGCTTCACCACCTTCTTGAcircRNAs = circular RNAs.
Interactions between differentially expressed circRNAs and miRNAs were investigated by using miRanda and Target Scan databases for predicting target miRNAs, whereby circRNAs that may function as miRNA sponges could be inferred. The network between circRNAs and miRNAs was also constructed by Cytoscape based on the binding sites of the differentially expressed circRNAs and miRNAs.
2.9. Statistical analysisData were analyzed with a mean ± standard deviation (mean ± SD) for the independent experiments. Statistical differences between the experimental groups were examined by analysis of variance followed by Newman–Keuls comparison multiple test and statistical significance was determined at a P value < .05, using SPSS version 20.0. Curve-fitting was carried out using the graphical package GraphPad Prism5.
3. Results 3.1. Differential expression of circRNAs in ICA treated hUMSCsThe flowchart shows the process of the study (Fig. 1). The HUMSCs and ICA-treated HUMSCs are shown in Figure 2. Generally, circRNAs were sequenced from hUMSCs (n = 3) and ICA treated hUMSCs (n = 3). The circRNA-seq reads and numbers in each sample are shown in Table 2. The differential expression of circRNAs in each sample was analyzed using hierarchical clustering assay (Fig. 3). There were 52 differentially expressed circRNAs (fold change ≥2.0) between hUMSCs and ICA treated hUMSCs group as shown by volcano plot (Fig. 4), including 32 up-regulated circRNAs and 20 down-regulated circRNAs. The detailed information of 52 differentially expressed circRNAs is shown in Table 3.
Table 2 - The circRNA-seq reads and numbers in normal hUMSCs (n = 3) and ICA treated hUMSCs groups. Sample Raw reads Mapped reads circRNA number C1 56916082 45018988 2492 C2 67469022 59350846 2975 C3 57941170 52328358 2844 ICA1 61958070 56595280 2960 ICA2 58842262 51965792 3188 ICA3 62377988 55284244 3252circRNAs = circular RNAs, hUMSCs = human umbilical cord mesenchymal stem cells, ICA = icariin.
circRNAs = circular RNAs.
Figure 1.: The flowchart showed the process of the study. circRNAs = circular RNAs, GO = Gene Ontology, hUMSCs = human umbilical cord mesenchymal stem cells, ICA = icariin, KEGG = Kyoto Encyclopedia of Genes and Genomes.
Figure 2.: The hUMSCs and ICA-treated hUMSCs. hUMSCs = human umbilical cord mesenchymal stem cells, ICA = icariin.
Figure 3.: Heatmap showed the hierarchical cluster analysis of circRNAs in hUMSCs group and ICA treated hUMSCs group (C: hUMSCs; ICA: ICA treated hUMSCs). Up-regulated circRNAs were indicated in red and down-regulated circRNAs were indicated in green. The relationship among the expression levels of samples was shown in dendrogram. hUMCSs group (n = 3), ICA treated hUMSCs group (n = 3). circRNAs = circular RNAs, hUMSCs = human umbilical cord mesenchymal stem cells, ICA = icariin.
Figure 4.: Fold changes of differentially expressed circRNAs in hUMSCs group and ICA treated hUMSCs group were visualized in volcano plot (C: hUMSCs; ICA: ICA treated hUMSCs). Differentially expressed circRNAs with fold change i 2.0, P < .05 were shown in red frame. hUMCSs group (n = 3), ICA treated hUMSCs group (n = 3). circRNAs = circular RNAs, hUMSCs = human umbilical cord mesenchymal stem cells, ICA = icariin.
3.2. Validation of the accuracy of circRNA-seq data by qRT-PCRqRT-PCR was used to verify the RNA sequencing data. We selected 12 circRNAs, including 6 up-regulated circRNAs (RNF13, LOC401320, PSD3, TBC1D1, RP11-632K20.7, GLIS3), 3 down-regulated circRNAs (UHRF2, NADK2, TRIO) and ZNF292, SMO, PTK2. As shown in Figure 5, the validation results were in agreement with RNA sequencing data, indicating that the circRNAs expression profiles were reliable.
Figure 5.: Expressions of 12 circRNAs in hUMSCs group and ICA treated hUMSCs group were measured using qRT-PCR. qRT-PCR results were in agreement with circRNA sequencing data. hUMCSs group (n = 3), ICA treated hUMSCs group (n = 3). *P < .05; **P < .01. circRNAs = circular RNAs, hUMSCs = human umbilical cord mesenchymal stem cells, ICA = icariin, qRT-PCR = quantitative real-time polymerase chain reaction.
3.3. GO analysis of differentially expressed circRNAs in hUMSCs after treated with ICAGO analysis was conducted to predict the biological process, cellular component, and molecular function according to the circRNAs sequencing data. Among biological process analysis, up-regulated circRNAs in ICA treated hUMSCs compared with hUMSCs were mainly crucial for regulation of ARF protein signal (GO:0032011) and ARF protein signal transduction (GO:0032012) with the enrichment score of 3.704108265, respectively. As for down-regulated circRNAs, the closely related GO terms were double-strand break repair (GO:0045003), DNA metabolic process (GO:0006259), cytoplasmic microtubule organization (GO:0031122), cellular protein localization (GO:0034613), cellular macromolecule localization (GO:0070727), nucleocytoplasmic transport (GO:0006913), and nuclear transport process (GO:0051169) with the enrichment score of 3.29392278380831, 3.13386352757553, 3.02758552372865, 3.02758552372865, 2.84759100105193, 2.8231674274097 and 2.8046015722301, respectively (Table 4). Cellular component analysis suggested that extrinsic component of membrane (GO:0019898), asymmetric synapse (GO:0031010), and ISWI-type complex (GO:0032279) were top 3 terms among up-regulated circRNAs with the enrichment score of 2.25881852185429, 1.83913495492281, and 1.83913495492281, respectively, whereas cytoplasmic side of plasma membrane (GO:0009898), endoplasmic reticulum tubular network (GO:0071782), and cytoplasmic side of membrane (GO:0098562) were top 3 terms among down-regulated circRNAs with the enrichment score of 1.89068113497619, 1.87370237396201, and 1.81940062594698, respectively (Table 5). Molecular function analysis suggested that ARF guanyl-nucleotide exchange factor activity (GO:0005086) and Ran GTPase binding (GO:0008536) were top 2 terms among up-regulated circRNAa with the enrichment score of 3.34794369596593 and 3.14471526292756, respectively, whereas kinase activity (GO:0016301), transferase activity (GO:0016740), transferase activity/transferring phosphorus-containing groups (GO:0016772), phosphotransferase activity/alcohol group as acceptor (GO:0016773) were top 4 terms among down-regulated circRNAs with the enrichment score of 3.8258283466276, 3.8258283466276, 3.4048814298804, and 3.04670051410215, respectively (Table 6).
Table 4 - Biological processes category in GO terms. Term (GO.ID) Enrichment score Associated genes Up-regulated ARF protein signal transduction(GO:0032011) 3.704108265 ARFGEF2//PSD3 Regulation of ARF protein signal transduction (GO:0032012) 3.704108265 ARFGEF2//PSD3 Regulation of glial cell differentiation (GO:0045685) 2.550591757 SERPINE2//TNFRSF21 Metabolic process (GO:0008152) 2.301185879 APLF//GLIS3//ASXL1//MNT//ARFGEF2//NFAT5//KLHL24//ASPHD1//BAZ1A//ZNF532//ZNF514//PTPN12//FBXW4//TNPO1//SERPINE2//SEC31A//TBC1D1//PSD3//TNFRSF21//RNF13//RANBP9 Regulation of gliogenesis (GO:0014013) 2.197050389 SERPINE2//TNFRSF21 Macromolecule metabolic process (GO:0043170) 2.122293645 APLF//GLIS3//ASXL1//MNT//ARFGEF2//NFAT5//KLHL24//BAZ1A//ZNF532//ZNF514//PTPN12//FBXW4//TNPO1//SERPINE2//ASPHD1//SEC31A//RNF13//RANBP9 Negative regulation of homotypic cell-cell adhesion (GO:0034111) 2.084961531 TNFRSF21//SERPINE2 Cellular macromolecule metabolic process (GO:0044260) 2.013194728 APLF//GLIS3//ASXL1//MNT//ARFGEF2//NFAT5//KLHL24//BAZ1A//ZNF532//ZNF514//PTPN12//FBXW4//SERPINE2//ASPHD1//SEC31A//RNF13//RANBP9 Regulation of B cell activation (GO:0050864) 1.931758798 TNFRSF21//APLF Single strand break repair (GO:0000012) 1.881585376 APLF Down-regulated Double-strand break repair via synthesis-dependent strand annealing (GO:0045003) 3.293922784 BARD1//BRIP1 DNA metabolic process (GO:0006259) 3.133863528 BARD1//BRIP1//ASCC1//SLF2//KPNB1//UHRF2 Cytoplasmic microtubule organization (GO:0031122) 3.027585524 DLG1//KPNB1 Cellular protein localization (GO:0034613) 2.862762922 KPNB1//PAN3//SMO//DLG1//BARD1//RBPMS//SLF2 Cellular macromolecule localization (GO:0070727) 2.847591001 KPNB1//PAN3//SMO//DLG1//BARD1//RBPMS//SLF2 Nucleocytoplasmic transport (GO:0006913) 2.823167427 KPNB1//SMO//BARD1//RBPMS Nuclear transport (GO:0051169) 2.804601572 KPNB1//SMO//BARD1//RBPMS Regulation of nucleocytoplasmic transport (GO:0046822)
留言 (0)