Mice

Cntnap2+/- mice at the C57BL/6 J background were acquired from the Jackson Laboratory (#017482). Inter-crossing between Cntnap2+/- mice was used to produce Cntnap2−/− mice and wild-type (WT) mice. The genotyping was performed by PCR as previously described.32 The generation of Necdin-deficient mice at the C57BL/6 J background was described previously.47 After weaning, mice of same gender and genotypes were group-housed with 3–5 mice per cage under controlled conditions (temperature, 20 ± 2 °C; relative humidity, 50–60%; 12 h light/12 h dark cycle) and had ad-lib access to food and water. All procedures regarding the care and use of animals were approved by the Ethics Committee of School of Life Sciences, Central South University of China. All methods were performed in accordance with approved guidelines.

Cell culture and transfection

HEK293T cells (ATCC) were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco). N2a cells (ATCC) were cultured in DMEM medium supplemented with 10% FBS, and mixed with OptiMem (Gibco) at volume ratio in 1:1. NN cells were maintained in DMEM supplemented with 15% FBS, 1% non-essential amino acid (NEAA, Invitrogen), 0.05‰ LIF (50 U/mL ESGRO Leukemia Inhibitory Factor, Millipore) and another 4 ul β-mercaptan ethanol (Sigma) per 500 mL right before use. All cells were authenticated and tested for mycoplasma contamination, and were maintained at 37 °C in an incubator containing 5% CO2. Plasmid and siRNAs were transfected into cells using Lipofectamine 2000 Reagent (Invitrogen) according to the manufacturer’s instructions.

Affinity purification of CICD

HEK293T cells were transfected with pRK5-HA-CNTNAP2-GFP-Flag plasmid, and treated with 5 µM MG132 (EMD) overnight at 48 h after transfection. The cell lysates were collected and pre-cleared with 200 µL of Sepharose 4B (Sigma) for 1 h at 4 °C. After centrifugation at top speed for 15 min, the supernatant was transferred into a fresh tube and incubated overnight with 20 µL anti-Flag M2 affinity gel (Sigma). The beads were harvested by centrifugation, washed extensively with lysis buffer at 4 °C, and boiled with 30 µL 1Xloading buffer. After centrifugation at top speed for 10 min, the supernatant was collected for SDS-PAGE.

Quantitative RT-PCR

Cells or tissues were extracted using TRIzol® reagent (Life technologies, USA) according to the manufacturer’s instruction. 2 μg of total RNA were reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA; K1622). The mRNA levels (20 ng of total cDNA equivalents) were examined with qPCR using Fast SYBR™ Green Master Mix (Thermo Fisher, USA; 4385612) according to the manufacturer’s instructions by a C1000 touch Thermal Cycler. Primers used for qPCR were shown as follow: Gapdh forward primer: AGGTCGGTGTGAACGGATTTG; Gapdh reverse primer: TGTAGACCATGTAGTTGAGGTC A; Necdin forward primer: GAGGTCCCCGACTGTGAGAT; Necdin reverse primer: TGCAGG ATTTTAGGGTCAACATC; Cntnap2 forward primer: CCTTGGCACCTAGATCACTTG; Cntnap2 reverse primer: CCCCTCCAATGATAGCTGAGTTT; Cask forward primer: TGGAAG CTCTACGCTACTGC; Cask reverse primer: GTTTAACAGGTGCCGAGTTTTC. Primers used for ChIP-qPCR were shown as following: P1 forward primer: CAACACGCATGCGCAATATC; P1 reverse primer: GATGCGGCTTGGAGCTCTT; P2 forward primer: CTAGTTCTGTGCCATACAGGAGAC; P2 reverse primer: GCGGGGCTGATGCGATATT; P3 forward primer: ACTCATCATCATCATAAGGTACAGC; P3 reverse primer: TGTGAAGGTCCTGGAGAAAGAC; P4 forward primer: ACATGGATTTATCTCCAGTGTCTG; P4 reverse primer: GGAAAGCTGTACCTTATGATGATG; P5 forward primer: GATCATTTTCCACTAGAATCTTAACGGAAG; P5 reverse primer: GCCCCACATGAAAATGAGGGATAT.

Nuclear and cytoplasmic protein isolation

N2a cells on 6 cm plates were transfected with 1 μg expression construct (pRK5, pRK5-HA-CNTNAP2-Flag, pRK5-CICD or pRK5-CICDΔPDZ respectively) or 10 μL siRNAs (20 μM) using Lipofectamine 2000 Reagent (Invitrogen) according to the manufacturer’s instructions. At 48 h after transfection, cells were washed with cold 1XDPBS (Gibco) and harvested using a cell scraper. Cells were transferred to a 1.5 mL Eppendorf tube and spun at 3000 g for 5 min at 4 °C. After removal of the supernatant, cells were re-suspended in 200 μL cytoplasmic extraction reagent (CER, 10 mM HEPES or Tris PH7.5, 40 mM KCl, 2 mM MgCl2, 10% glycerol and 1×Protein Inhibitor Cocktail) and incubated for 10 min on ice. Further, cells were blown softly about 25–40 times with a 1 mL syringe until the suspension was thick. The suspension was centrifuged at 4,000 g for 5 min at 4 °C and the supernatant (cytoplasmic fraction) was transferred to a new Eppendorf tube. The pellet was washed twice with 1XDPBS. Thereafter, the pellet was re-suspended in 3 mL 0.25 M sucrose solution (0.25 M sucrose, 1 M MgCl2, 1 M HEPES PH 7.5) and transferred carefully to a 15 mL Falcon tube containing 3 mL 0.35 M sucrose solution (0.35 M sucrose, 1 M MgCl2, 1 M HEPES PH 7.5). Then, the density gradient centrifugation was done at 1430 g for 5 min at 4 °C. The supernatant was removed and the pellet (nuclear fraction) was re-suspended in 200 μL nuclear extraction reagent (NER, 10 mM HEPES or Tris PH7.5, 500 mM NaCl, 1%Triton-X100, 10% glycerol and 1×Protein Inhibitor Cocktail). The suspension was ultrasonicated on ice for 20 s and centrifugation for 15 min at 13,000 g. Then, the samples were mixed with 2×SDS lysis buffer and boiled for 10 min. After centrifugation for 5 min at 13,000 g, the supernatant (nuclear fraction) was transferred to a new Eppendorf tube.

The mPFC was dissected and cut into small pieces. After addition of cytoplasmic extraction reagent (200 μL per 60 mg), tissues were transferred into Dounce Tissue Homogenizer and fully homogenized. The homogenate was transferred to a 1.5 mL Eppendorf tube and spun at 1500 g for 5 min at 4 °C. The supernatant was left as cytoplasmic fraction, whereas the pellet was further processed as above.

Western blotting

The samples were mixed with 2×SDS lysis buffer (50 mM Tris–HCl at pH 6.8, 2% SDS and 10% glycerol) with 1×Protein Inhibitor Cocktail, boiled at 100 °C for 10 min. The supernatant was obtained by centrifugation at 13,000 g for 10 min and the protein concentration was determined using the PierceTM BCA protein Assay kit (Thermo Fisher). Proteins in lysates were separated by SDS-PAGE, transferred to PVDF membranes, and blocked in 5% skim milk that contained 0.1% Tween 20 at room temperature for 1 h. The membranes were immunoblotted with the corresponding antibodies overnight at 4 °C, and then were washed and incubated with horseradish peroxidase conjugate secondary antibodies at room temperature for 1 h. After washing, the bands were visualized using the Pierce™ ECL Western Blotting Substrate kit (Thermo Fisher) and band intensities were quantified by ImageJ. The antibodies were listed as following: CNTNAP2 (ab33994, Abcam), Necdin (ab18554, Abcam), Flag-tag (14793, CST), HA-tag (3724, CST), GFP (2555, CST), CASK (ab252540, Abcam), GAPDH (97166, CST), Histone H3(9715, CST), PS1 (ab15458, Abcam).

Chromatin immunoprecipitation (ChIP)

N2a cells were transfected with 3 μg plasmids (pRK5-Myc or pRK5-CASK-Myc) using Lipofectamine 2000 Reagent (Invitrogen) according to the manufacturer’s instructions. At 48 h after transfection, fresh 37% formaldehyde was added to cultured cells to a final concentration of 1%. After incubation at room temperature for 10 min, 1/20 volume of 2.5 M glycine was added to quench formaldehyde. The cells were rinsed twice with cold 1XDPBS (Gibco) and harvested using a silicon scraper. The cells were then transferred to a 1.5 mL Eppendorf tube and spun at 1350 g for 5 min at 4 °C. After removal of the supernatant, cells were re-suspended in 500 μL Lysis Buffer1 (50 mM Hepes-KOH, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100) and incubated at 4 °C for 10 min. After spinning at 1,350 g for 5 min at 4 °C, each pellet was resuspended in 500 μL Lysis Buffer 2 (10 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA). After rocking gently at room temperature for 10 min, the nuclei were pelleted in tabletop centrifuge by spinning at 1350 g for 5 minutes at 4 °C. Each pellet was resuspended in each tube in 200 μL Lysis Buffer 3 (10 mM Tris-HCl, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-Deoxycholate, 0.5% N-lauroylsarcosine). The suspension was sonicated with a microtip attached to Misonix 3000 sonicator in an ice water bath. 50 µL of 10% Triton X-100, 200 µL Lysis Buffer 3, 5 μL cocktail, and 5 μL anti-Myc (CST, 2276 S) were added to each sample and incubated overnight at 4 °C. 15 μL beads (Thermo Fisher) was added and incubated at 4 °C for 4 h. The beads were washed with 1 mL Wash Buffer (50 mM Hepes-KOH, 500 mM LiCl, 1 mM EDTA, 1% NP-40, 10% Na-Deoxycholate) and eluted with 100 µL elution buffer (50 mM Tris-HCl, 10 mM EDTA, 1% SDS) at 65 °C with agitation for 2-3 h. 3-4 µL of 25 mg/mL RNaseA was added into each sample and incubated at 65 °C with agitation for 4-5 h, then 2 µL of 10 mg/mL proteinase K was added and incubated at 55 °C with agitation for 4-5 h. 200 µL AMPure XP Beads (Beckman, A63881) was used to extract DNA for qPCR assay.

Luciferase reporter assays

HEK293T cells were plated on 24-well plates and transfected with 20 ng, 40 ng, 80 ng of pRK5-CASK, 5 ng pGL3-Necdin promoter-Luc and 10 ng of pCMV-β-gal. At 48 h after transfection, cells were washed twice with PBS and lysed with Reporter Lysis Buffer (Promega). The extracts were assayed for luciferase activity with the Luciferase Assay System (Promega). Luciferase activities were determined using SIRIUS luminometer (Berthold Detection Systems GmbH).

Three-chamber social interaction test

Male mice at the age of 6–8 weeks were used. Mice were habituated to the experimenter for at least 3 days prior to the start of the behavioral experiments. Animals were allowed to acclimate to the behavioral testing room for at least 1 h before the first trial begins. The apparatus was a clear Plexiglas box divided into three interconnected equally-sized interconnected chambers (left, center, right), mouse was able to access each chamber from the center through the retractable doorways. There are two phases in the three-chamber social interaction test: habituation and sociability.67

At habituation phase, we placed two plexiglas cages in left and right chambers, the position was counter balanced in order to avoid bias, and two identical objects were placed inside. A subject mouse was introduced into the central chamber, and was allowed to explore three chambers for ten min. During habituation, the subject’s position was tracked continuously with an automated tracking software.

At sociability phase, an age- and sex-matched stranger mouse was enclosed in a plexiglas cage so that the social interaction was only initiated by the test mouse. To measure the sociability, we placed the subject mouse into the central chamber, and allowed it to explore the three-chamber apparatus for ten minutes. The behaviors were recorded and Anilab Software (Anilab) was used to score the time that the subject mouse spent on sniffing or climbing upon each plexiglas cage. We used the following formulate to calculate the preference index: Preference index =Time exploring (stranger mouse – object) / Time exploring (stranger mouse + object).

Reciprocal interaction test

We placed a male mouse at the age of 6–8 weeks in a cage and allow it to habituate for 10 min. Then, a novel conspecific matched mouse according to genotype, age, sex, and/or treatment was placed in a neutral arena. The time spent in social interaction of both animals was measured by two independent observers blind to the genotypes, including touching, close following, nose-to-anus sniffing, nose-to-nose sniffing, grooming and/or crawling over/under each other.68

Grooming test

We placed a male mice at the age of 6–8 weeks in a Plexiglas column (20 cm diameter). The behaviors were recorded for 10 min after 10 min acclimation. The time spent on grooming themselves was measured by a researcher who is blind to the genotypes.

Stereotaxic injection

Adeno-associated viruses carrying genes for EGFP (rAAV-EF1a-EGFP-WPRE-hGH pA, AAV-EGFP), CICD (rAAV-EF1a-CICD-P2A-EGFP-WPRE-hGH pA, AAV-CICD) or Necdin (rAAV-EF1a-Necdin-P2A-EGFP-WPRE-hGH pA, AAV-Necdin) was used. AAV-EGFP (AAV2/9, 2.46 × 1012 genomic copies per mL), AAV-CICD (AAV2/9, 5.55 × 1012 genomic copies per mL), AAV-Necdin (AAV2/9, 5.61 × 1012 genomic copies per mL) were made by BrainVTA (Wuhan). WT or Cntnap2−/− mice (4 weeks old), randomly allocated for different virus injection, were anesthetized with isoflurane (induction 4%, maintenance 1%) and placed in a stereotaxic frame (RWD). The skull was exposed under antiseptic conditions and a small craniotomy was made with a thin drill over prefrontal cortex (typical coordinates: 1.98 mm anterior to Bregma; ±0.4 mm lateral to the midline). AAV-EGFP, AAV-CICD or AAV-Necdin were injected using a glass micropipette (tip diameter ~15 µm) attached to a Nanoliter 1000 pressure injection apparatus. Over a 10 min period, 0.2 µL of virus was injected at a depth of 1.65 mm from the Bregma. The pipette remained for 10 min at the end of infusion to allow virus diffusion. When pulled out, pipette remained for 1 min per 0.05 mm lift to localize virus. The mice were sutured and placed on a hot blanket until they woke up. Behavior experiments were conducted at 3 weeks after virus injection.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 9.3.0. Except behavior tests, all experiments were repeated at least three times. Data were presented as mean ± SEM and the exact statistical tests each experiment were stated in the Figure legend.