Clinical samples collection

The study protocols were approved by the Ethics Committees of Huazhong University of Science and Technology Union Shenzhen Hospital and the Affiliated Shenzhen Sixth Hospital of Shenzhen University and performed in line with the provisions of the Helsinki Declaration of 1975. After being obtained written informed consent from the patients according to institutional guidelines, a total of 30 fresh breast tissues from 20 patients with BC and 10 patients with hyperplasia of the mammary glands were harvested during breast surgery. None of the subjects had received probiotic or antibiotic administration for at least three months before the sample collection.

F. nucleatum detection

To assess the amounts of F. nucleatum, gDNA extracted from breast tissues of patients with BC or hyperplasia of the mammary glands was subjected to qPCR to test the Bacterial 16 S rRNA genes by using PGT as a reference gene [27]. The primers sequences used to detect F. nucleatum and PGT were listed as followed: forward F. nucleatum, CAACCATTACTTTAACTCTACCATGTTCA, reverse F. nucleatum, GTTGACTTTACAGAAGGAGATTATGTAAAAATC; forward PGT, ATCCCCAAAGCACCTGGTTT, reverse PGT, AGAGGCCAAGATAGTCCTGGTAA. F. nucleatum abundance in tumor versus normal breast tissue was calculated based on the 2−ΔΔCt method [28]. Reaction conditions of amplification and detection were referred to in a previous study described by Castellarin, Warren, Freeman, Dreolini, Krzywinski, Strauss, Barnes, Watson, Allen-Vercoe, Moore and Holt [27].

F. nucleatum culture and conditioned media collection

F. nucleatum strain ATCC 25,586 was grown in BD™ Columbia agar containing defibrinated sheep blood (5%) and cultured in an anaerobic chamber at 37 °C.

F. nucleatum conditioned media were collected once in two days, followed by sterile filtration using a 0.22-µm syringe filter. The filtered media was stored at -80 °C before EVs isolation.

EVs isolation and characterization

EVs isolation was performed as an ultracentrifugation protocol reported in a recent study [29]. In brief, to obtain the F. nucleatum-derived EVs (Fn-EVs), the collected F. nucleatum-conditioned media were ultracentrifuged at 200,000× g for 60 min. Next, the obtained pellets were subjected to resuspension with PBS and filtered by a 0.22-µm syringe filter to finally obtain pure Fn-EVs.

The characterization of Fn-EVs, which included their morphology, number, size distribution, and protein concentration was performed using a transmission electron microscope (TEM), nanoparticle tracking analysis (NTA) with Nano-ZS 90 dynamic light scattering, and bicinchoninic acid (BCA) assay.

Cell culture and treatment

Two BC cell lines (MDA-MB-231 and MCF-7) supplied by ATCC were grown in DMEM media with 10% FBS at 37 °C. To investigate the effect of Fn-EVs on BC cells, cells were divided into three groups: control, Fn, and Fn-EVs groups. After cell confluence reached approximately 85%, cells were given diverse treatments according to different groups (control: PBS; Fn: F. nucleatum suspension (1⋅109 CFU/mL); Fn-EVs: 10 µg Fn-EVs.) and further incubated for a certain time.

CCK-8

The cell viability was detected by CCK-8 assay. In brief, after BC cell incubating with diverse treatments for 24, 48, and 72 h, cells seeded in 96-well plates were added with 10% CCK-8 reagent (Dojindo) and cultivated for another 2 h, followed by being subjected to detecting the optical density (OD) of each well at 450 nm with a microplate reader (Bio-Rad, Hercules, CA, USA).

Edu staining

According to protocols provided by the manufacturer, EdU Staining Proliferation Kit was utilized to assess the proliferation of cells after finishing different treatments. By using a BX51 microscope, images were obtained to observe and calculate EdU-positive cells.

Wound healing

To evaluate the cell migration, a density of 2 × 105 cells/well was seeded into six-well plates. The 200-µL pipette tip was utilized to create a similar size of scratches after a monolayer of cells had formed. Then, scratched cells were removed by three gentle rinses of PBS; the remaining cells were given diverse treatments and cultured in DMEM without FBS for 24 h. A BX51 microscope was utilized to photograph the same position of scratches at 0 and 24 h after scratching.

Transwell

The invasive ability of BC cells was also evaluated by using Transwell chambers pre-coated with Matrigel. Briefly, BC cells were seeded into the upper chambers containing 200 µL DMEM with or without F. nucleatum or Fn-EVs. Simultaneously, 700 µL DMEM with serum was added to the lower chamber. After 24 h cultivation, cells still in the upper chamber were removed, while cells traversing the membranes to the lower chamber were fixed in 4% PFA and stained with 0.1% crystal violet for 15 min. Under a BX51 microscope, the stained cells were photographed and counted in six random visual fields.

Western blot

BC cells from different groups were lysed with RIPA Buffer on ice to obtain the total protein. After determining the concentration of total protein by the BCA method, the quantitated protein was separated on SDS-PAGE gels and subsequently transferred onto PVDF membranes. Membranes were blocked with skimmed milk, followed by incubation with anti-TLR4 or anti-GAPDH antibodies. Next, the membranes were rinsed thrice with TBST prior to incubation with the secondary antibody. Finally, by using an ECL kit, the protein bands were visualized, of which intensities were measured by Image J. The antibodies information was presented in Supplementary Table S1.

RT-qPCR

By using Rneasy reagents (Qiagen), total RNA was prepared from tissues or cells. After the quantification and integrity analysis of total RNA, 1 µg total RNA was subjected to reverse transcription using a Reverse Transcription System Kit (Promega) to obtain cDNA. Using an SYBR Premix EX Taq™ II kit (Takara), qRT-PCR was carried out on a Bio-Rad system to detect the expression of TLR4. The relative expression of TLR4 was calculated with GAPDH as the internal control based on the 2−ΔΔCT method [28]. Primer sequences were presented in Supplementary Table S2.

Cell transfection

Short hairpin (sh) RNA against TLR4 (sh-TLR4#1, sh-TLR4#2, and sh-TLR4#3:) and the scrambled negative control (sh-NC) were purchased from Genepharma (China). The shRNA sequences were presented in Supplementary Table S2. When cell confluency was about 60%, MDA-MB-231 cells were transfected with sh-TLR4#1/2/3 or sh-NC for 48 h using Lipofectamine 2000 (Invitrogen). After transfection finished, cells were harvested and transfection efficiency was analyzed.

Animal experiments

All procedures regarding animals in this study were approved by the Institutional Animal Care and Use Committee of Huazhong University of Science and Technology Union Shenzhen Hospital and the Affiliated Shenzhen Sixth Hospital of Shenzhen University. All methods were carried out in accordance with relevant guidelines and regulations and ARRIVE guidelines (https://arriveguidelines.org) for the reporting of animal experiments. Before the beginning of in vivo study, thirty-six BALB/c nude mice (female, 6–8 weeks, 18-22 g) purchased from Guangdong medical laboratory animal center were subjected to one-week acclimation. MDA-MB-231 cells were stably transfected with either sh-NC or sh-TLR4 lentivirus before being subcutaneously injected into nude mice.

In brief, mice were randomly divided into three groups (n = 6/group): LV-sh-NC + PBS, LV-sh-NC + Fn-EVs, and LV-sh-TLR4 + Fn-EVs groups. On day one, 1 × 106 sh-NC transfected MDA-MB-231 cells (the former two groups) or TLR4-silencing MDA-MB-231 cells were subcutaneously injected into the inguinal mammary fat pads of mice. One week later, mice were given intratumorally PBS or Fn-EVs (100 µg/mL) for two weeks. Tumor formation was monitored beginning at day 7 every three days, and the growth curve of tumors (volume = (L × W2)/2, where W represents the width, and L represents the length) was plotted. One day 28, mice were sacrificed by cervical dislocation, and tumors were therefore harvested and weighed.

For the study of BC metastasis to the liver, the groups defined as above-mentioned, MDA-MB-231 cells were injected into the portal vein of the liver of mice on day one. One week later, mice were given PBS or Fn-EVs (100 µg) via the tail vein for two weeks. After finishing the treatment (day 28), liver tissues were dissected and subjected to H&E staining to investigate liver metastasis.

Statistics

Pearson’s chi-squared test was applied to analyze the associations between F. nucleatum abundance and patient clinical characteristics. Data were represented as the mean ± SD and analyzed using the student t-test or one-way analysis of variance followed by Tukey’s post hoc test on GraphPad Prism software. P < 0.05 means that the difference is significant.