Cells

Mouse bone marrow derived macrophages (BMDMs) were collected from the tibia and femur of pathogen-free six-week-old female C57BL/6 mice obtained from DooYeol Biotech. (Seoul, South Korea). The cells were cultured in α-Minimal Essential Medium containing 30% L929 cell-conditioned medium and 10% FBS for 7 days. The medium was changed every 2–3 days.

Ethics statement

All animals were maintained according to the Guidelines for the Care and Use of Laboratory Animals of the Institute of Laboratory Animal Center, Daegu-Gyeongbuk Medical Innovation Foundation (Approval Number: DGMIF-17061301-00).

Materials

All chemical reagents including hexadecyl trimethyl ammonium bromide (CTAB), tetraethyl orthosilicate, 3-mercaptopropyl-triethoxysilane (MPTES), lipopolysaccharides (LPS) from Escherichia coli O111:B4, MK-801, glutamate, NMDA, rapamycin, BAPTA-AM, N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide (W-7), and trifluoperazine (TFP) were purchased from Sigma Aldrich Chemical Co. (St. Louis, MO, USA). Rabbit IgG isotype control was obtained from Abcam (Cambridge, United Kingdom). NMDAR1 polyclonal antibody was obtained from Invitrogen of Thermo Fisher Scientific Co. (Waltham, MA, USA). CellMask™ green plasma membrane stain and Hoechst 33342 (Trihydrochloride) were purchased from Thermo Fisher Scientific. Phosphate buffered saline (PBS, pH7.4) and 4% paraformaldehyde (PFA) were supplied by Biosesang (Seoungnam, South Korea). FSD Fluor™ 647 dye was purchased from BioActs Co. (Incheon, South Korea).

Chemical treatment

Cells were treated with the NMDAR antagonist MK-801 (150 μM), LPS (100 ng/mL), the mTOR inhibitor rapamycin (25 nM), the calcium chelator BAPTA-AM (2 μM), glutamate (300 μM), NMDA (300 μM), and the calmodulin inhibitor W-7 (20 μM) or TFP (20 μM) for 24 h.

siRNA transfection

BMDMs were transfected with control siRNA, mouse siGrin1, sip65 (Santa Cruz biotechnology, Dallas, TX, USA) using VIROMER Blue (Lipocalyx, Weinbergweg, Halle, Germany).

Western blot analysis

Protein from BMDMs lysates was resolved NuPAGE 4%-12% gels (Thermo Fisher Scientific) or Tris–Glycine gel, and transferred to PVDF membranes (Millipore, Burlington, MA, USA). After blocking with 5% skim milk, the membranes were incubated with primary antibodies at 4 °C overnight. Primary antibodies against the following proteins: iNOS, HIF-1α (Novus, Centennial, CO, USA), NMDAR1 (Abcam), p-p65 (S536), p65, p-PI3K (Y458), PI3K, p-AKT (T308), AKT, p-p70S6K (T389), p70S6K, and LDHA (Cell Signaling Technology, Danvers, MA, USA), and Actin (Sigma). The HRP-conjugated secondary antibodies were used to incubate the membranes for 2 h at room temperature. Membranes were detected using Image Quant LAS-4000 (GE Healthcare, Chicago, IL, USA).

Quantitative RT-PCR

The total RNA from BMDMs were isolated using the Trizol Reagent (Thermo Fisher Scientific) and total RNA was reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). cDNA was used for subsequent qRT-PCR using the SYBR-Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). The primer sequences were as follows: Grin1 forward, AACAGCAACAAAAAGGAGTGGAA, and reverse, GCGCACGCTCATTGTTAATG; Grin2A forward, GAACGCGAACTTCGAAATCTG, and reverse, TCTTAGGGTCAGTGCGGTTCA; Grin2B forward, CTGCCCTCCTCCAAACACA, and reverse, CATCCGATCGAATCAAGTCA; 36B4 forward, ACCTCCTTCTTCCAGGCTTT, and reverse, CTCCAGTCTTTATCAGCTGC. Gene expression was normalized to that of the endogenous reference gene, 36B4.

Measurement of cytokines

The concentrations of cytokines were measured using mouse IL-1β, TNF-α, and IL-6 ELISA kit purchased from Thermo Fisher Scientific. Data were normalized against standard controls in the kit.

ECAR measurement

Cells were seeded into the XF24 Microplates (Agilent, Santa Clara, CA, USA) to measure the extracellular acidification rate (ECAR: an indicator of glycolysis) using seahorse XF24 analyzer (Agilent). ECAR readings were measured from each treatment groups. Seahorse datasets were normalized to the protein contents.

Measurement of calcium levels

BMDMS were seeded overnight at 5 × 104 cells per well in a 96-well black wall/clear bottom microplate. Cytosolic Ca2+ levels in BMDMs were measured using FLUOFORTE® Calcium assay kit (Enzo Life Sciences, Farmingdale, NY, USA).

Production of NMDAR-FSD Fluor™ 647 (N-TIP) and Isotype-FSD Fluor.™ 647 (I-TIP)

2 mg/mL solution of Rabbit IgG monoclonal Isotype Control (Abcam, Prod # ab172730) and Anti-NMDAR1 antibody (Thermo Fisher Scientific, Prod # PA3-102) in pH 7.4 PBS buffer at ambient temperature was treated with 20-fold excess FSD Fluor™ 647 (BioActs, Prod # KOSC1315) and shaken for 1 h in a dark. Reaction mixtures were loaded in Sephadex G-25 columns, purified by eluting with pH 7.4 PBS buffer. Then dye-conjugated antibodies were concentrated more than 1 mg/mL. To analyze the optical properties of both conjugates, absorbance spectra were obtained with Nanodrop 2000 (Thermo Fisher Scientific), and fluorescence spectra were analyzed with LS 55 Fluorescence Spectrometer (PerkinElmer) (Additional file 1: Fig. S1). NMDAR-FSD Fluor™ 647 was briefly called as N-TIP (NMDAR Targeting Imaging Probe), and Isotype-FSD Fluor™ 647 was called as I-TIP (IgG Targeting Imaging Probe).

$$\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\,\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\,\mathbf\mathbf\mathbf\mathbf\mathbf\,\left(\mathbf/\mathbf\mathbf\mathbf\mathbf\mathbf\mathbf\right)=\frac}}_}}}}}}}}\times }}_}}}}}}}_}}}}\left\}}_-\left(}}_}}}}\times }}}_\right)\right\}}$$

\(}}_}}}}}}}}\) = Protein molar extinction coefficient. The typical molar extinction coefficient of IgGantibody is ~ 210,000 M-1cm-1\(}}_}}}}\) = molar extinction coefficient of FSD Fluor™ 647 (239,000 M−1 cm.−1)

\(}}_}}}}\) = Absorbance of Protein–dye conjugate at \(_\)(nm) for dye.

\(}}_\) = Absorbance of Protein–dye conjugate at \(_\)(nm) for protein.

\(}}}_\) = Correction factor; adjusts for the amount of absorbance at 280 nm caused by the dye; 0.03 for FSD Fluor™ 647.

Flow cytometry

BMDMs were processed into single cell suspensions, then fixated 4% paraformaldehyde for 10 min at 4 °C, and incubated with antibodies (Mouse F4/80-FITC, and Mouse CD11b-FITC; Thermo Fisher Scientific, I-TIP, N-TIP) for 1 h at 4 °C. The cells were then washed twice with flow buffer, and resuspended in 0.5 ml of flow buffer for analysis. Flow cytometry was performed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA). Flow cytometric analysis was performed on FlowJo software (FlowJo, Ashland, OR, USA).

Isolation of peritoneal macrophages

Eight-week-old male C57BL/6 J mice were intraperitoneally (i.p.) injected with LPS (2 mg/kg). At 10 min post-injection, the mice were i.p. injected with N-TIP (0.4 mg/kg) or I-TIP (0.4 mg/kg) for 24 h. Peritoneal cells were harvested through peritoneal lavage and then western blot analysis was performed.

Three-dimensional (3D)-based image analysis

BMDMs were stabilized after seeding in a 96-well plate, a black wall surface on a transparent bottom. Cells were treated with or without LPS for 24 h. Prior to the imaging, the cells were fixed in 4% PFA for 10 min, and then I-TIP and N-TIP were incubated at 4 °C for 18 h. After washing with PBS, staining with CellMask™ green and Hoechst 33342, images were obtained from Operetta CLS (PerkinElmer, Waltham, MA, USA) using red (615–645 nm), green (460–490 nm), and blue (355–385 nm) excitation wavelengths. A 40X water lens was used for the 3D-based image, and the z-stack imaging was taken by dividing the size of -10 m to + 3 m by 1 m, and then combined using Harmony 4.9 (PerkinElmer) software.

In vivo imaging

In vivo imaging of either LPS- or CG-induced inflammation using N-TIP was obtained as follows: PBS and inflammation inducing agents including 2% LPS solution or 1% carrageenan (CG) solution were subcutaneously administered to footpads of mice (n = 5, each group). At 10 min post-injection, a single dose of 0.4 mg/kg FSD Fluor™ 647 conjugated IgG antibody (IgG-FSD Fluor™ 647 called as I-TIP) or FSD Fluor™ 647 conjugated NMDAR1 antibody (NMDAR1-FSD Fluor™ 647 called as N-TIP) was intravenously administered followed by fluorescence imaging. In case of IVISense Cat B 680 FAST, the recommended dose (2 nM) was intravenously administered according to the manufacturer’s instructions.

The anti-inflammatory effect of dexamethasone (DEX) using N-TIP was evaluated as follows: 1% carrageenan (CG) solution were subcutaneously administered to footpads of mice (n = 5, each group). A single dose of 10 mg/kg DEX was administered intraperitoneally to the mice immediately after inflammation induction. At 10 min post-injection, 0.4 mg/kg N-TIP was intravenously administered, followed by in vivo fluorescence imaging. After image acquisition, the organs were removed for ex vivo imaging.

In vivo fluorescence images were acquired using an IVIS Spectrum CT (PerkinElmer). The scan times ranged from 1 to 2 s depending on the intensity of the emitted fluorescence signal. All in vivo FL signals were obtained with the following settings: Ex/Em for FSD Fluor™ 647 and IVISense Cat B 680 FAST, 651/667 and 675/693 nm; exposure time, 1–2 s; f/stop, 2; binning, 8; and field of view, 21.8. The image was thresholder to maximize visualization of the region of interest and minimize background fluorescence. Grayscale and fluorescence color images were superimposed using LIVINGIMAGE v 2.12 (PerkinElmer) and IGOR Image Analysis FX (Wave Metrics, Lake Oswego, OR, USA) software. Signal intensity is expressed in units of Total Radiant Efficiency [p/s]/[µW/cm2].

Statistical analysis

All data are expressed as the mean ± standard deviation (SD) from at least three independent experiments, and statistical significance of the difference was determined by unpaired Student’s t-test using GraphPad Prism 6 (GraphPad Software, San Diego, CA). P-values less than 0.05 were considered statistically significant.