Metabolic syndrome (MS) is an interconnected combination of biochemical, clinical, and metabolic factors. MS manifests as adipose tissue expansion, insulin resistance (IR), type 2 diabetes mellitus (T2DM), elevated blood pressure, and cardiovascular disease. The prevalence of MS ranges from < 10% to more than 84% worldwide, depending on the geographic distribution, the guidelines for diagnosis used, and differences in the studied population regarding their race, age, sex, and ethnicity [1, 2]. The MS prevalence frequently coincides with obesity and T2DM prevalence. According to the National Health and Nutrition Examination Survey (NHANES), the MS prevalence represents 60% among obese people, 22% among overweight, and 5% among normal weights [3]. Moreover, about 70–80% of diabetic patients have been diagnosed with MS [4].

Therefore, increasing lipolysis in adipose tissues surges hepatic free fatty acid uptake, lipid accumulation, and fatty liver disease [5]. Adipose tissue remodeling associated with obesity alters the synthesis of adipokines such as tumor necrosis factor (TNF-α), leptin, and adiponectin. Leptin and TNF-α are positively correlated with body obesity and contribute to promoting inflammation and IR development [6]. Adiponectin may be the only adipokine decreases in obesity and MS. It is also negatively correlated to hepatic IR and liver fat content [7].

Insulin-like growth factor-1 (IGF-1) is a hepatokine expressed locally in the liver in addition to many other tissues, particularly adipose tissues. Low IGF-1 levels are observed in obesity-induced liver dysfunction [8, 9]. So, IGF-1, leptin, and adiponectin are considered non-invasive biomarkers for non-alcoholic fatty liver diseases (NAFLD) diagnosis [10].

Sirtuin -1 (SIRT-1) is a nicotinamide adenine dinucleotide (NAD +)—dependent deacetylase. It acts as a fuel-sensing molecule that regulates ATP synthesis and helps to restore the body's energy balance. SIRT-1 may be crucial in lowering fat deposition and improving glucose tolerance and insulin sensitivity, which may therefore improve all of the symptoms of MS, especially adiposity and fatty liver [11].

Resveratrol is a natural polyphenol compound and SIRT-1 activator. It has many biological and pharmacological properties, including anti-inflammatory and antioxidant effects, suggesting a role in MS treatment and its related disorders [12]. Resveratrol supplementation improved glucose tolerance by modulating the glucose metabolism in skeletal muscle and liver in pigs with MS [13]. It also positively influenced the hepatic oxidative stress (OS) in a rat model of MS with a high fructose diet [14]. The anti-obesity effect of resveratrol is through decreasing lipogenesis and increasing lipolysis in adipose tissues [15]. Moreover, resveratrol increases the brown adipose tissue activity to restore thermogenesis [16].

Dulaglutide, a glucagon-like peptide-1(GLP-1) receptor agonist, is approved for T2DM and obesity treatment. It mediates insulin release in response to elevated glucose levels, increases insulin sensitivity, decreases glucagon secretion, modifies β-cell damage, delays stomach emptying, and reduces appetite [17]. Several studies reported that GLP-1 agonist therapy is effective in the reduction of body weight and NAFLD [18, 19].

Since obesity and NAFLD are strongly associated with T2DM and IR in MS, and their current management with weight loss and exercise is insufficient, the discovery of novel therapeutic alternatives has become necessary. Dulaglutide is efficient and well-tolerated, although it could still have different adverse effects, such as gastrointestinal symptoms, low risk of acute pancreatitis, and renal damage [17]. Therefore, the current focus is introducing a safe medicine (or more) of natural origin that is used for long periods without experiencing many side effects, like resveratrol. So, we conducted this study to evaluate the effectiveness of resveratrol versus dulaglutide on the adipose tissue and liver in a metabolic syndrome rat model, investigating the possible underlying mechanisms.

Materials and methods Animals

Twenty-four male Wistar rats aged one month, weighing 130–150 g were maintained under conventional laboratory conditions of temperature (20 ± 5ºC) with a regular 12 h light/dark cycle throughout the study.

Ethical statement

The Ethics Committee of Research, Faculty of Medicine, Fayoum University approved the experimental protocol of this study (R226 / 92–2022). All procedures of the experiment followed the standard guidelines and regulations of the US National Research Council "Guide for the Care and Use of Laboratory Animals.”

Experimental design

Rats were divided into four groups (six rats/each): Normal Control group fed ad libitum standard chow and tap water. Untreated metabolic syndrome (MS) group; fed a high-fat/high-sucrose (HF/HS) diet (5% sheep fat; 5 g fat /100 g of standard chow and 10% sucrose in drinking water for eight weeks). MS + Dulaglutide group (dulaglutide 0.6 mg/kg twice weekly injected subcutaneously, purchased from Eli Lilly, Japan) (corresponding 8 fold human equivalent dose (HED), based on plasma area under the curve [20] and MS + Resveratrol group (resveratrol was given 30 mg/kg daily orally, purchased from Xian Lukee Bio-Tech Co., Ltd.) [21]. Induction of metabolic syndrome in the last three groups was confirmed by elevated systolic and diastolic blood pressure, blood glucose > 200 mg/dl, and body mass index (BMI) > 0.7 g/cm2.

Anthropometric measurements

On the day of dissection, body weight (BW), body length, white visceral adipose tissues including mesenteric, perirenal, and epididymal fat were weighed, calculation of BMI (g/cm2) as Weight g / Length cm2, and Lee index [LI = body weight (g) 1/3 × 1000 / body length (cm)] [22].

Blood pressure measurement

A computerized non-invasive blood pressure system, CODA™ (Kent Scientific, Torrington, CT, USA) used to measure tail rat blood pressure weekly using volume pressure method. Values of systolic (SBP), diastolic (DBP) blood pressure, and heart rate (HR) were recorded.

Blood sampling and biochemical measurements

At the end of the experiment, all animals fasted for 12 h and underwent light anesthesia with inhaled diethyl ether. We collected intra-cardiac blood sample, centrifuged, and separated serum for determination of glucose, total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and alanine aminotransferase (ALT), kits produced by BioSystem S.A Costa Brava, Barcelona, Spain. Serum VLDL-C and LDL-C levels were calculated by using the Friedewald formula [23] as follows:

$$\begin\mathrm-\mathrm=\mathrm/5\\ \mathrm-\mathrm=\mathrm-\mathrm-\mathrm-\mathrm/5.\end$$

We measured serum insulin with ELISA kits (Cusabio, Inc., Houston, Texas, USA) according to the manufacturer’s instructions. Estimation of Homeostasis model assessment of insulin resistance (HOMA-IR) was by using the following formula [24]: HOMA-IR = fasting glucose (mg/dl) × fasting insulin (µU/ml) / 405.

Tissue sampling and homogenate preparation

After sacrification, we preserved specimens of the liver and visceral fat in 10% buffer-neutral formalin for histology and immunohistology study. Other parts were homogenized in 0.1-M phosphate buffer (pH 7.4) to get 20% w/v tissue homogenates which were centrifuged at 3000 × g for 30 min in 4 °C. The supernatants were collected, preserved at – 70 °C for biochemical measurements.

Lipid membrane damage was determined by measuring malondialdehyde (MDA) level used the Biodiagnostic kit [25]. We measured adiponectin and leptin levels using ELISA kits, according to the manufacturer’s instructions (Calbiotech, Austin, USA).

Quantitative assessment of Peroxisome Proliferator-Activated Receptor gamma (PPARγ) gene expression by real-time PCR

Total RNA was extracted from liver and adipose tissue homogenate utilizing Qiagen extraction kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions. RNA concentrations and purity were measured with a Nanodrop ND-2000 spectrophotometer (Thermo Scientific Inc., USA) and kept at -80 °C. Reverse transcription of RNA was carried out using QuantiTect reverse transcription kit (Qiagen) as described in the manufacturer’s protocol. The expression of PPARγ gene was done by RT-thermal cycler (MJ Research Inc, Watertown, Massachusetts, USA) with a Fast Start DNA Master SYBR Green I kit (Roche Diagnostics, Indianapolis, IN, USA) following the manufacturer’s protocol. Glyceraldehyde-3 phosphate dehydrogenase (GAPDH) was utilized as an internal control for data normalization.

Real-time PCR was implemented in a total volume of 20 µl comprising: 2 µl of cDNA, 10 µl of Syber Green PCR Master Mix (Roche Diagnostics USA), and 10 pmol of each primer. Thermal cycling conditions were utilized, involving a 95ºC step for 10 min, followed by 40 cycles of 95ºC for15 seconds, 60ºC for 1 min, and 72ºC for 1 min. Relative expression of the intended gene mRNA was calculated utilizing the 2−∆Ct method.

Primer sequences utilized for:

PPARγ were; Forward 5ˋ- GCTACCGTTCCTCTATCAATGACA-3ˋ,

Reverse 5ˋ- CAGATTTATTCAGCTTTGCCTCAG -3ˋ.

GAPDH were; Forward 5ˋ- GTGACTTTATGGAGCCTAAGTTTG -3ˋ,

Reverse 5ˋ- AGCTATAAATATGGCCAAGTCACT-3ˋ.

Western blotting of hepatic SIRT-1

Protein was extracted from liver tissues with RIPA lysis buffer supplemented with 1 mM phenylmethanesulfonyl fluoride and 1 mM protein phosphatase inhibitor. Then, the sample was centrifuged for 10 min at 12,000 r/min at 4 °C. The proteins were separated on 10% (w/v) SDS–polyacrylamide gels and transferred onto polyvinylidene fluoride membranes. The membranes were blocked with 5% (w/v) milk (Bio-Rad) for 2 h at room temperature and then incubated overnight at 4 °C with primary antibodies against SIRT-1 (Santa Cruz Biotechnology kit, Inc., Santa Cruz, California, USA) and β-actin (1:1000, Proteintech). Next, the membranes were washed with TBS with 0.05% Tween 20 (TBST) three times and incubated with horseradish peroxidase-conjugated secondary antibodies for 60 min. The signals were detected with a ChemiDocXRS + Imaging System (Tanon, Shanghai, China) [26].

Histopathology

The epididymal fat pads and liver specimens in 10% formalin were embedded in paraffin wax by routine protocol. 5 μm thick sections were stained with Haematoxylin and Eosin (H&E) for histological examination. Periodic acid–Schiff (PAS) histochemistry technique was used to demonstrate glycogen accumulation [27].

Immunohistochemical staining was done using: l. IGF-1 rabbit polyclonal antibody (Novus Biological USA, Catalog NO. NBP2-16929). Human breast carcinoma was used as a positive control. II. TNF-α rabbit polyclonal antibody (Thermo Fisher US, Catalog NO. PA5-120124), human lung carcinoma was the positive control (as provided by the manufacturer).The reaction of both IGF-1 and TNF-α was cytoplasmic. Negative control slides were done by omitting the primary antibodies.

Quantitative morphometric study

The following parameters were measured by using “Toup view” image analyzer computer system (China): The diameters of 20 randomly selected adipocytes from H&E-stained sections of the epididymal fat at × 100 magnification [28]. Area percent of IGF-1 and TNF-α immune-stain in adipose and liver tissues, area percent of hepatic PAS reaction were taken in ten randomly selected non-overlapping fields/slide at × 100 magnification.

Statistical analysis

We used SPSS, version 18.0, for data analysis after being checked for completeness and normality. We expressed it as mean and standard deviation (SD), using One-way ANOVA (analysis of variance) for comparisons of study variables between groups, followed by post-hoc (Tukey test) for multiple inter-group comparisons. Pearson correlation was used to test the association between quantitative study variables. We considered the data significant at p value < 0.05.

ResultsEffects of treatment on the anthropometric measurements

Compared to the control group, the untreated MS group showed positive indicators of obesity: including a significant increase in BW, body gain percentage, BMI, LI, and visceral fat weight (p < 0.05). While treatment with dulaglutide and resveratrol showed significantly decreased values of all these parameters compared to MS (p < 0.05). With non-significant changes between the results of the two drugs (Table 1, Fig. 1A).

Table 1 Effects of treatment on anthropometric, hemodynamic, biochemical, and histologic parameters in experimental groupsFig. 1

Effect of dulaglutide and resveratrol on different parameters in all experimental groups; (A): Starting body weight (BW starting), final body weight (BW final), weight change percent, and Lee index, (B): Serum total cholesterol (TC), triglyceride (TG), high-density lipoprotein-C (HDL-C), low-density lipoprotein-C (LDL-C) and very low-density lipoprotein-C (VLDL-C), (C): Malondialdehyde (MDA), (D): Adiponectin, (E): Leptin, (F): PPARγ gene expression. Abbreviations: MS: Untreated metabolic syndrome group, MS + Dulaglutide: dulaglutide treated group. MS + Resveratrol: Resveratrol treated group, Data represent mean ± SD, using One-way ANOVA test for comparisons of study variables between groups, followed by post-hoc Tukey test for multiple inter-group comparisons. Significance difference at P-value < 0.05. a Significant compared to control, b Significant compared to MS group, c Significant compared to MS + Dulaglutide group

Effects of treatment on SBP, DBP, and HR

MS results showed significantly (p < 0.05) increased SBP, DBP, and decreased HR values in comparison to the control group. After treatment with dulaglutide and resveratrol, the levels of SBP and DBP decreased while HR increased compared with MS group. The reduction of SBP and DBP with resveratrol treatment was significant compared to dulaglutide (p < 0.05) (Table 1).

Effects of treatment on serum biochemical measurements

The mean values of serum glucose, insulin, and HOMA-IR in the MS group significantly increased compared to the control group (p < 0.05). The results of the two drugs showed a significant decrease compared to MS. Dulaglutide treatment decreased the values of serum glucose and HOMA-IR more than the resveratrol one (p < 0.05) (Table 1).

MS group revealed significantly increased serum TC, LDL-C, VLDL-C, TG, and ALT levels associated with decreased HDL-C compared with the control group (p<0.05). Dulaglutide and resveratrol-treated groups significantly reversed these parameters. In comparing the results of both drugs, resveratrol treatment significantly (p < 0.05) reduced TC, TG, LDL-C, and VLDL-C. While dulaglutide significantly increased HDL-C, with no significant changes between them on ALT level (p > 0.05) (Fig. 1B).

Effects of treatment on the hepatic and adipose tissue measurementsMalondialdehyde, adiponectin, and leptin levels

The MS results showed significantly increased mean levels of malondialdehyde and leptin with decreased adiponectin (p < 0.05). Compared to the MS group, dulaglutide and resveratrol treatment significantly reversed these levels (p ˂ 0.05) (Fig. 1C, D, E).

PPARγ gene expression

The Expression of hepatic and adipose PPARγ in the MS group was significantly decreased compared to the control group (p ˂ 0.05). Both drugs significantly increased the expression in comparison to the MS group. Meanwhile, there was a significant increase in adipose PPARγ with resveratrol treatment in comparison to dulaglutide (p ˂ 0.05) (Fig. 1F).

Western blotting of hepatic SIRT-1 protein

The hepatic SIRT-1protein was downregulated in the MS group relative to the control group. While in dulaglutide and resveratrol groups, the expression showed a significant increase (p ˂ 0.05). There was no statistically significant difference between both drugs in the expression values (Fig. 2A).

Fig. 2

Effect of dulaglutide and resveratrol treatment on (A): Hepatic SIRT-1 protein expression, (B): Area percentage of Insulin growth factor-I (IGF-1) immuno-stain, (C):.Area percentage of Tumor necrosis factor- α (TNF- α) immuno-stain. Abbreviations: MS: Untreated metabolic syndrome group, MS + Dulaglutide: dulaglutide treated group. MS + Resveratrol: Resveratrol treated group, Data represent mean ± SD, using One-way ANOVA test for comparisons of study variables between groups, followed by post-hoc Tukey test for multiple inter-group comparisons. Significance difference at P-value ˂ 0.05. a Significant compared to control, b Significant compared to MS group, c Significant compared to MS + Dulaglutide group

Correlations analysis between different parameters

In the present work, oxidative and inflammatory biomarkers such as MDA and TNF-α were positively correlated, and with tissue leptin, while negatively associated with adiponectin, PPARγ, IGF-1, and SIRT-1. Adiponectin and PPARγ were positively correlated, and with tissues IGF-1 and SIRT-1, but negatively correlated with leptin. However, results of HOMA-IR were positively correlated with leptin and TNF-α, while negatively associated with adiponectin, PPARγ, IGF-1, and hepatic SIRT-1 (Table 2).

Table 2 Statistical correlations using Pearson Correlation test among different parametersHistological resultsControl group

Examination of epididymal white adipose connective tissue (WAT) revealed average-sized adipocytes and positive cytoplasmic IGF-1 immuno-reaction in most adipocytes and connective tissue (CT) cells. TNF-α immuno-stain showed minimal cytoplasmic immuno-reaction (Figs. 3A, 4A, E). Liver examination revealed normal histological architecture with radiating hepatocytes cords from central veins. Hepatocytes had granular acidophilic cytoplasm and vesicular nuclei. Positive PAS histochemical reactions are distributed mostly equally in all zones (Figs. 5A, 6A). We detected that most cells expressed positive cytoplasmic IGF-1 immuno-reaction in contrast to TNF-α (Fig. 7A, E).

Fig. 3

A photomicrograph of H&E stained epididymal white adipose connective tissue sections from all experimental groups: control group (A), reveals polyhedral unilocular adipocytes with peripheral nuclei and well-defined cell boundaries (arrows). Minimal perivascular inflammatory cells infiltration (right-angled arrows) can be detected. MS group, (B) shows apparently large adipocytes (arrows). Some adipocytes appear with ruptured cell boundaries (star). Evident perivascular inflammatory cells infiltration (right-angled arrows) also can be detected, MS + Dulaglutide (C) and MS + Resveratrol (D) groups show well-defined apparent large adipocytes (arrows). (H&E stain, Scale bar = 50 µm)

Fig. 4

A photomicrograph of epididymal white adipose connective tissue sections from all experimental groups immuno-histochemicaly stained with: (I): IGF-1: Control group (A), shows extensive positive cytoplasmic immuno-reaction in most of adipocytes (arrows) and connective tissue (C.T.) cells in between adipocytes (curved arrow). MS group (B) shows mild immuno-reactivity in adipocytes (arrows) and negative immuno-reaction in C.T. cells (curved arrows). MS + Dulaglutide (C) and MS + Resveratrol (D) groups exhibit strong cytoplasmic immuno-reaction in both of adipocytes (arrows) and C.T. cells (curved arrows). (II): TNF-α: Control group (E), expresses minimal cytoplasmic immuno-reaction in adipocytes (arrow) and C.T. cells (curved arrow). In MS group (F), marked TNF-α immuno-reactivity is found in most of adipocytes (arrows) and C.T. cells (curved arrow). MS + Dulaglutide (G) and MS + Resveratrol (H) groups, show mild immuno-reaction in adipocytes (arrows) and C.T. cells (curved arrows) (IGF-1 immuno-stain (A, B, C, D) & TNF-α immuno-stain (E, F, G, H) Scale bar = 20 µm)

Fig. 5

A photomicrograph of H&E-stained liver sections from all experimental groups: Control group (A), shows normal histological architecture with radiating cords of hepatocytes from central veins (CV). Portal area (encircled) (having branches of portal vein (V), hepatic artery (A) as well as bile duct (D)) is situated in the corners of the ill-defined classic hepatic lobule. Hepatocytes (arrows) appear with granular acidophilic cytoplasm and vesicular nuclei with prominent nucleoli, some are binucleated (arrowheads). MS group (B, C, D) shows many vacuolated hepatocytes with dark peripherally situated nuclei (dotted arrows). Others have deep acidophilic cytoplasm and small dark pyknotic nuclei (hollow arrows). Extravasation of erythrocytes (right-angled arrows), as well as inflammatory infiltration (curved arrows) with both of lymphocytes (red arrows) and macrophage (green arrows) are obvious findings. MS + Dulaglutide group (E), shows normal vesicular hepatocytes (arrows). Mild erythrocytes extravasation (right-angled arrow) and inflammatory infiltration (curved arrows) could be detected. MS + Resveratrol group (F) exhibits apparent normal hepatic architecture with normal hepatocytes (arrows). (H&E stain Scale bar = 50 µm (A, B, C, E, F), 10 µm (D))

Fig. 6

A photomicrograph of PAS-stained sections of the liver from all experimental groups: control group (A) shows normal distribution of glycogen in the hepatocytes. Positive histochemical reactions (arrows) are distributed mostly equal in all hepatic lobule zones: zone I (peripherally located area of classic hepatic lobule close to portal area), zone II (area between zone I and III) and zone III (area around central vein). MS group (B) shows apparent negative reaction in zone II and III. Few hepatocytes in zone I exhibit positive reaction for PAS (arrows). MS + Dulaglutide group (C) exhibits strong PAS positive reactivity (arrows) in zone I and II as well as many hepatocytes reveal moderate PAS reactivity (dotted arrow) in zone III. MS + Resveratrol group (D) shows intense PAS positive reactivity in sporadic cells (arrows) that are distributed apparently equal in all zones (I, II, III). (PAS stain, Scale bar = 50 µm)

Fig. 7

A photomicrograph of liver sections from all experimental groups immuno-histochemicaly stained with: I: IGF-1: Control group (A), shows extensive cytoplasmic immuno-reaction in the majority of hepatocytes (arrows). MS group (B) reveals that the immuno-reaction is restricted to few hepatocytes (arrows). IGF-1 immuno-staining (arrows) was detected in large number of hepatocytes in both MS + Dulaglutide (C) and MS + Resveratrol (D) groups. II: TNF-α: in control group (E), few hepatocytes express cytoplasmic immuno-reaction (arrows). MS group (F) showed that TNF-α immuno-stain (arrows) was found in most liver cells. In both MS + Dulaglutide (G) and MS + Resveratrol (H) groups, some hepatocytes were seen expressing the immuno-stain (arrows). (IGF-1 immuno-stain (A, B, C, D) TNF-α immuno-stain (E, F, G, H) Scale bar = 50 µm)

MS group

Adipocyte size increased significantly (P < 0.05) compared to the control group. Some adipocytes showed visible perivascular inflammatory cell infiltration and damaged cell borders (Fig. 3B). IGF-1 immunoreactivity in adipocytes was minimal, but immunoreactivity in CT cells was negative. Immuno-reaction area percentage decreased significantly. The area percentage of TNF-α immunoreactivity showed a significantly increase (Figs. 2B, C, 4B, F).

Upon liver inspection, we saw several vacuolated hepatocytes with dark peripheral nuclei. Other hepatocytes had deep acidophilic cytoplasm and tiny dark pyknotic nuclei. It was clear that there had been erythrocyte extravasation and inflammatory infiltration (Fig. 5B, C, D).

There was a negative reaction in zones III and II with a residual positive PAS reaction in a small number of hepatocytes in zone I. There was a much lower proportion of PAS reaction area in liver sections compared to control (Fig. 6B, Table 1). Compared to control, TNF-α reaction significantly increased, but we found IGF-1 immuno-reaction only in a small number of hepatocytes with a considerable drop in area % (Figs. 2B, C, 7F, B).

Dulaglutide treated group

We found large-sized adipocytes with clearly defined boundaries, but there was a considerable decrease in diameter compared to the MS group (Fig. 3C, Table 1). Compared to the MS group, there was a significant rise in IGF-1 immunoreactivity and a decrease in TNF-α (Figs. 2B, C, 4C, G). Hepatocytes appeared normal except for a small number that had black pyknotic nuclei (Fig. 5E). When compared to the MS group, there was a discernible rise in PAS reactivity (Fig. 6C, Table 1). Opposed to the MS group, there were noticeably higher levels of IGF-1 and lower levels of TNF-α immuno-expression in hepatocytes (Figs. 2B, C, 7C, G).

Resveratrol treated group

WAT examination revealed large-sized adipocytes with well-defined boundaries. Compared to the MS group, we detected a significantly decreased adipocyte diameter (Fig. 3D, Table 1). Significant increased IGF-1 while decreased TNF-α immune-reactivity were noticeable (Figs. 2B, C, 4D, H). Resveratrol improved the liver tissues, appearing with normal architecture (Fig. 5F). PAS reaction (area percentage) revealed a significant increase compared to the MS group. Intense PAS-positive reactivity in sporadic cells is distributed equally in all zones of the hepatic lobule (Fig. 6D, Table 1). We observed significantly increased IGF-1 immuno-reaction and decreased TNF-α compared to the MS group (Figs. 2B, C, 7D, H). Resveratrol revealed a significant difference in the ameliorating effects compared to dulaglutide regarding the adipocytes diameter, the area percentage of IGF-1 in adipose and liver tissues, and TNF-α in adipose tissue. Whereas there was a non-significant difference in the area percentage of PAS reaction and TNF-α in liver tissue (Fig. 2B, C, Table1).