Human hepatocellular carcinoma specimens

Forty-five samples of human hepatocellular carcinoma tissue and paired paraneoplastic tissues were obtained from patients who underwent surgery at Qilu Hospital of Shandong University between June 2011 and June 2021. The tissues were removed, and stored in liquid nitrogen. Written informed consent was obtained from each patient and family members in accordance with the requirements of the Ethics Committee of Qilu Hospital, Shandong University.

Cells and cell culture

The HCC cell lines Huh-7, HMCC-97H, SMMC-7721, HepG2, and Hep3B were kind gifts from Zhao-ru Dong (Department of Hepatobiliary Surgery, Qilu Hospital, Shandong University). The HCC cell lines were cultured in Dulbecco’s modified eagle medium (DMEM) (Gibco, Beijing, China) supplemented with 10% fetal bovine serum (FBS) (Gibco, Beijing, China) in a humidified atmosphere at 37 °C and 5% CO2.

Oligonucleotide and plasmid transfection

The negative control (NC), BRF2 small interfering (si) RNA, BRF2 overexpression plasmid (OE), miR‐409‐3p inhibitor, and miR‐409‐3p mimics were all purchased from Gene Pharma (Shanghai, China). LGK974 was obtained from MedChemExpress (Monmouth Junction, NJ, USA). Huh-7 cells were plated into 6‑well plates at a density of 1 × 105 cells per well and cultured for 24 h until they reached 80% confluency. The medium was then replaced with 1.5 mL fresh DMEM without antibiotics or antimycotics. Transfections were performed by mixing Lipofectamine 2000 (Invitrogen, Rockford, IL, USA), 100 pmol siRNA (NC or BRF2), miR‐409‐3p inhibitor, or miR‐409‐3p mimic, and OptiMEM (Thermo Fisher Scientific, Rockford, IL, USA). This mixture was incubated with Huh-7 cells for 6 h. The medium was then discarded and replaced with DMEM with 10% FBS. The targeting sequences were as follows: BRF2 siRNA, GCACUUACAUGCAGAUAGUTT; siRNA‑NC, UUCUCCGAACGUGUCACGUTT; miR‐409‐3p inhibitor, AGGGGUUCACCGAGCAACAUUC; miR‐409‐3p mimic, GAAUGUUGCUCGGUGAACCCCUGGGUUCACCGAGCAACAUUCUU. Cells were collected for protein and RNA analysis 12 h after transfection.

Real-Time Quantitative Polymerase Chain Reaction (RT‑qPCR)

We used Triazole reagent (Invitrogen) to extract total RNA from cells or human tissues, according to the manufacturer’s instructions. The concentration of RNA was measured using a NanoDrop ultra-violet spectrometer (Thermo Fisher Scientific). The cDNA was reverse‑transcribed from the mRNA using the Prime Script RT reagent kit (TaKaRa, Tokyo, Japan). Real-time PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems, Rockford, IL USA) with 3 sub-well replicates. Thermocycling conditions were chosen according to the manufacturer’s protocol. All results were normalized to GAPDH mRNA. The primers for GAPDH and BRF2 were: GAPDH, forward GCACCGTCAAGGCTGAGAAC and reverse TGGTGAAGACGCCAGTGGA; BRF2 forward as mentioned above. Relative gene expression was then analyzed using the ΔΔCq method. Each experiment was performed at least three times.

Western blotting

Western blotting was performed as described previously [14]. Total protein in cells and tissues was extracted with RIPA lysis buffer (Thermo Fisher), and the protein concentration was determined using the Pierce bicinchoninic acid Protein Assay kit (Thermo Fisher Scientific). Proteins were separated by 10% SDS-PAGE in running buffer (Servicebio, Wuhan, China), and then were transferred on to polyvinylidene difluoride membranes (Millipore Corporation, Bedford, MA, USA) in transfer buffer (Servicebio). The membranes were blocked in 5% non-fat milk, then incubated with primary antibodies overnight at 4 °C. The primary antibodies were: rabbit anti‑E‑cadherin (ab40772, 1:1000, Abcam, Cambridge, UK), rabbit anti‑N‑cadherin (ab18203, 1:1000, Abcam), anti-β-catenin (ab32572,1:1000, Abcam), anti-APC (ab40778, 1:2,000, Abcam), anti-GSK3 beta (ab32391, 1:2000, Abcam), anti-Axin2 (ab109307, 1:1000, Abcam), anti-CK1 (ab302638, 1:1000, Abcam), anti-wnt5A (ab229200, 1:1000, Abcam), mouse anti‑GAPDH (sc-47724, 1:1000, Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA), mouse anti-BRF2 (sc-390312,1:1000, Santa Cruz Biotechnology Inc). GAPDH served as an internal control. The membranes were washed and incubated with the secondary antibody goat anti-rabbit IgG H&L (ab150113, 1:2,000, Abcam) or goat anti-mouse IgG H&L (ab6789, 1:2,000, Abcam) at 37 °C for 2 h, then washed with 0.9% TBST three times. The membranes were then incubated with the enhanced chemiluminescence kit (Millipore Corporation, Bedford, MA, USA) for visualization.

Wound‑healing assay

Transfected cells were trypsinized and passaged in six-well plates at a density of 1 × 105 cells per well. When cells reached 100% confluence, wounds were made in the monolayer with a sterile 1 mL pipette tip. The cells were washed three times using PBS to clear detached cells, followed by incubation with DMEM without FBS at 37 °C. The healing process was observed and the average distance between cells was calculated using ImageJ software (version 6.0).

Transwell invasion and migration assay

For the invasion assay, we precoated the bottom of the upper chambers of transwell plates (8 μm, Corning Costar, MA, USA) with Matrigel (BD Biosciences, San Jose, CA), diluted at a ratio of 1:8. Cells in serum-free medium were seeded on to the filter of the upper chambers, and DMEM containing 10% FBS was added to the lower chambers. The plates were then incubated for 48 h. For the migration assay, the plates were not precoated in Matrigel. After 48 h, non-invading cells were gently removed with a cotton swab. The invading cells were fixed in 4% paraformaldehyde for 15 min, then stained with 0.1% crystal violet solution for 30 min. The images were taken from five randomly selected areas under the microscope.

Luciferase activity analysis

293 T Cells and Smmc-7721 Cells were transfected with 200 ng pmirGLO plasmid using Lipofectamine 2000 (Invitrogen) with NC mimic + BRF2-WT, hsa-miR-409-3p mimics + BRF2-WT, NC mimic + BRF2 mut, or hsa-miR-409-3p mimics + BRF2-mut. The renilla luciferase reporter vector pRL-TK was used as an internal control. After 48 h following transfection, firefly and renilla luciferase activities were sequentially detected by the Dual Luciferase Reporter Assay system (Promega, Madison, WI, USA).

Animal study

The animals were used according to an experimental protocol approved by the Medical Experimental Animal Care Commission of Shandong University. For the in vivo metastasis assay, 4–5-week-old female immunodeficient mice (nude mice; 5 per group) were injected were injected with 1 × 106 cells that were transfected with either NC lentivirus (control) or BRF2 knockdown lentivirus (sh-BRF2) through the lateral tail vein. The mice were then executed six weeks later according to standard procedure. The livers and lungs were collected and fixed in 10% buffered formalin. The lung samples were embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E).

Immunohistochemistry

Paraffin sections of tumor tissues were cut at a thickness of 5 μm. Sections were incubated with the primary antibody anti-CK8 (ab53280, 1:200, Abcam) at 4 °C overnight. Sections were incubated with HRP‐polymer-conjugated secondary antibodies after washing with phosphate‐buffered saline, and then they were immunostained using a DAB plus kit (ZSGB-Bio, Beijing,China).

Statistical analysis

Data analysis was performed by SPSS statistical software (version 11.5). Numerical data are shown as the mean ± SEM (standard error of mean). Comparison of categorical variables was calculated using Fisher’s exact test or χ2 test. Two-tailed tests were used for statistical analysis. Statistical significance was considered to be P < 0.05.