Naturally occurring glucocorticoids (GCs) and their synthetic analogs, such as prednisolone and dexamethasone, are known to be widely used in medical practice due to their anti-inflammatory, desensitizing, immunosuppressive, and antiallergic properties (Cooper, 2012). However, long-term GC supplementation for the treatment of arthritis, asthma, chronic obstructive pulmonary disease and, especially now, COVID-19 increases the risk of developing a number of adverse complications, including their significant toxic effects on the central nervous system (CNS) (Alan and Alan, 2017). GC-induced neurotoxicity manifests itself in the form of impaired motor and sensory functions, emotional status, as well as integrative functions of the brain, such as memory and learning. These effects are predominantly, but not exclusively, mediated by dysfunction of the hippocampus as this structure is highly sensitive to glucocorticoids (Conrad, 2008). For example, elevated levels of GCs have been shown to cause atrophy of dendritic processes in the CA3 region, loss of hippocampal neurons, and increased neuronal damage in pathological conditions such as seizures and stroke (Patil et al., 2007; Tata and Anderson, 2010). In addition, possible mechanisms of the neurotoxic effect of GC include disruption of GR-associated signaling pathways, cross-links between transcription factors, glucocorticoid receptor (GR) polymorphisms, effects on DNA methylation and other molecular networks involved in switching between autophagy/apoptosis, mitophagy, proliferation/cell differentiation. The target effect of glucocorticoids also covers the functioning of the blood–brain barrier (BBB), astrocytes, microglia, neurons and their dendritic architecture (Obradovic et al., 2006; Fietta et al., 2009; Kim et al., 2010; Kadmiel and Cidlowski, 2013; Sorrells et al., 2014). It is known that GCs can block transendothelial transport of glucose in the CNS, as well as its uptake by hippocampal neurons and glial cells (Horner et al., 1990), thereby disrupting energy metabolism in the brain and affecting the basic functions of neurons. In addition, the negative effects of GCs may be associated with their ability to potentiate the excitotoxic effects of glutamate and reduce the inhibitory effect of GABA in the CNS (Di et al., 2009). However, there have been conflicting data from animal models showing that the glucocorticoid dexamethasone has both neuroprotective and neurotoxic effects in a dose- and time-dependent manner (Abrahám et al., 2001; Lear et al., 2014). These conflicting data raise the question of the known degree of caution in the therapeutic use of glucocorticoids.
Currently, there is no complete clarity regarding the nature of GC-associated changes in the CNS, and the molecular mechanisms underlying the development of GC-induced structural and functional abnormalities in the CNS, cognitive and behavioral disorders are poorly understood. In this regard, difficulties may arise in solving the urgent biomedical problem of finding the most effective pharmacological approaches for the correction and/or prevention of GC-induced neurotoxicity.
Vitamin D3 (VD3, cholecalciferol) has previously been shown to play an important role as a para- and autocrine neurosteroid that modulates multiple CNS functions, including brain development, neurotransmission, neuroprotection, and immunomodulation (Kalueff and Tuohimaa, 2007). VD3 can easily cross the BBB (Won et al., 2015) and realize its biological action in the brain through its own vitamin D3-auto/paracrine system (Cui et al., 2017), which consists of several major components. Vitamin D3 receptor (VDR) is a key player that binds the hormonally active form of VD3, 1,25-dihydroxyvitamin D3 (1,25(OH)2D3, calcitriol). The VDR is a member of the nuclear receptor superfamily and is present in both the developing and adult brains. In the brain of adult rats, VDR is found in neurons, astrocytes (Brown et al., 2003), and oligodendrocytes (Baas et al., 2000) of various brain areas. 25-hydroxyvitamin D3 (25OHD3) is considered to be the main transport form of VD3 and its storage metabolite delivered to body cells via vitamin D-binding protein (VDBP) (Shymanskyi et al., 2020). 1,25(OH)2D3 can be synthesized and metabolized locally in the CNS from 25OHD3. This process is provided by 25-hydroxyvitamin D3 1a-hydroxylase (CYP27B1), which is found in neurons and glial cells (Landel et al., 2018). Another important component of the VD3-auto/paracrine system is 1,25-dihydroxyvitamin D3 24-hydroxylase (CYP24A1), an enzyme that catabolizes 1,25(OH)2D3 to inactive 1,24,25(OH)3D3 followed by conversion to calcitroic acid. Thus, a tight balance between the VD3 metabolism enzymes plays a pivotal role in maintaining an appropriate local level of 1,25(OH)2D3 for brain function. We have previously shown that chronic administration of GCs is accompanied by the development of a profound VD3 deficiency (Shymans’kyǐ et al., 2014). It is mainly due to impaired 25OHD3 synthesis in the liver as a result of a simultaneous increase in hepatocellular necrosis and caspase-3-dependent apoptosis (Lisakovska et al., 2017). However, it remains an open question to what extent VD3 deficiency may exacerbate glucocorticoid toxicity in the CNS.
In addition, many psychiatric and neurological diseases, including multiple sclerosis (Smolders et al., 2013), schizophrenia (Cui et al., 2021), Parkinson’s disease (Fullard and Duda, 2020), diabetic peripheral neuropathy (Xiaohua et al., 2021), and other age-related neurological outcomes (Berridge, 2017) correlate with low plasma levels of 25OHD3, suggesting that adequate VD3 levels may prevent, cure, or at least alleviate some mental disorders. Therefore, in the context of understanding the role of vitamin D3 in the functioning of the CNS, both under normal and diseased conditions, it is important to establish whether chronic administration of GCs can affect the circulating pool of VD3 and alter the ratio of the main components of the VD3-auto/paracrine system, as well as to what consequences these changes at the molecular, cellular, functional and behavioral levels can lead to.
Given all of the above, the aim of the study was to identify the relationship between vitamin D status and behavioral, structural, functional, and molecular changes associated with neurotoxicity caused by the synthetic glucocorticoid prednisolone in experimental rats. For the fullest characterization of vitamin D status in animals, we measured the circulating pool of VD3 (serum and cerebrospinal fluid (CSF) levels of 25-hydroxyvitamin D3), local 25OHD3 content in brain tissues, and the levels of major components of VD3-auto/paracrine system in the brain tissue—VDR, VDBP, CYP27B1, and CYP24A. To evaluate behavioral changes associated with prednisolone and vitamin D3 administration, we performed the forced swim test (FST), open-field test (OFT), elevated plus maze (EPM), and conditioned fear test. Histological changes were examined by staining the hippocampus, cortex, thalamus, and cerebellum with hematoxylin-eosin (H&E) or toluidine blue. At a functional level, we performed recording of an array of microelectrodes of hippocampal networks to study long-term synaptic plasticity (LTP). Depolarization-induced exocytosis in isolated nerve endings of the rat brain and the rate of fusion of synaptic vesicles with plasma membranes were also detected. To complete a comprehensive study of the mechanisms of neuroprotective action of vitamin D3 under glucocorticoid toxic load, we finally evaluated molecular changes at the level of GR, nuclear factor κB (NF-κB) p65 subunit and its phosphorylated form (at Ser 311), NF-κB inhibitor (IκB), poly(ADP-ribose)polymerase-1 (PARP-1), covalent protein modifications as the markers of oxidative-nitrosative and genotoxic stress (poly(ADP)-ribosylated (PAR), carbonylated and nitrated proteins) in brain tissue.
2. Materials and methods 2.1. Animals and general experimental designFemale Wistar rats (100 ± 5 g) were housed at the Animal Facility of the Palladin Institute of Biochemistry with free access to a standard rodent diet and drinking water ad libitum. Animals were kept in a temperature-controlled room and exposed to a daily 12/12 h light/dark cycle. The general scheme of animal experimental design and timescale are shown in Figure 1. After acclimatization for 1 week, the rats (n = 60) were randomly divided into three experimental groups: (1) the control group (n = 20); (2) the group that received the synthetic glucocorticoid prednisolone (5 mg/kg of body weight, per os, 30 days, n = 20); (3) the group that received prednisolone (5 mg/kg of body weight) and vitamin D3 (1,000 IU/kg of body weight, per os, 30 days, n = 20). Glucocorticoid prednisolone (30 mg/ml) was purchased from Biopharma (Ukraine) and was solved in the purified water for injections for further oral administration to rats. Vitamin D3 (cholecaciferol, Sigma-Aldrich, USA, C9756) was administered to rats as oil solution. At the end of the experimental treatment, the rats were anesthetized by intraperitoneal injection of chloral hydrate (40 mg/100 g of body weight), decapitated with a guillotine, and blood was taken from the inferior vena cava. The brain was quickly dissected and transferred to the appropriate buffer depending on the following procedures. All samples that were not used immediately were stored at −80°C.
Figure 1. Schematic representation of the experimental design and timescale. Each experimental group included 20 animals: (1) The control group that received purified water (0.1 ml) and oil solution (0.1 ml) as vehicles; (2) the group with glucocorticoid-induced neurotoxicity, in which rats received orally the water solution of synthetic glucocorticoid prednisolone (Biopharma, Ukraine) at a dose of 5 mg/kg of body weight (30 days) and additionally oil solution (0.1 ml) as vehicle; (3) the group that received the oil solution of vitamin D3 (Sigma-Aldrich, USA, C9756) at a dose of 1,000 IU/kg of body weight per os (30 days) on the background of prednisolone administration (5 mg/kg of body weight). Behavioral procedures (OFT, open-field test; FST, forced swim test; EPM, elevated plus maze; C/C FC, contextual/cued fear conditioning test) were performed during 3 days before the decapitation with the concurrent drug administration (n = 8 per group). At the end of the experimental treatment, the rats were anesthetized by an intraperitoneal injection of chloral hydrate (40 mg/100 g of body weight), decapitated with a guillotine. Blood samples were taken from the inferior vena cava to measure 25OHD3 by ELISA (n = 20 per group). The whole brain was quickly dissected and was used fresh (for synaptosome preparation, n = 4–5) or transferred into the appropriate buffer depending on the procedures: 10% formalin solution in cold 0.1 M phosphate-buffered saline (pH 7.4)—for histological assessment (n = 5 per group); an ice-cold solution of oxygenated (95% O2, 5% CO2) artificial cerebrospinal fluid (ACSF) solution (119 mM NaCl, 2.5 mM KCl, 2.0 mM CaCl2, 1.3 mM MgCl2, 26 mM NaHCO3, 1.0 mM NaH2PO4, 11 mM glucose, pH 7.35)—for electrophysiological studies (n = 5 per group); and a liquid nitrogen—for western blotting, RT-PCR and ELISA (n = 8 per group).
2.2. Ethical statementWe performed all animal procedures in accordance with the protocols approved by the Animal Care Ethics Committee of the Palladin Institute of Biochemistry (Protocol #1, 26/01/2018), adopted on the basis of national and international directives and laws relating to animal welfare: European Convention for the protection of vertebrate animals used for experimental and other scientific purposes (Strasbourg, France; 1986), Bioethical expertise of preclinical and other scientific research conducted on animals (Kyiv, Ukraine; 2006).
2.3. Behavioral procedures 2.3.1. Open-field test (OFT)The rats were examined in a testing apparatus (1.0 × 1.0 m polypropylene box with 0.5 m-height walls) with a floor divided into 25 equal squares. The box was illuminated with white light (60 lx) during testing. Animals were individually placed in a corner of the box and allowed to freely explore the environment for 10 min. The following parameters were evaluated: the total distance traveled (mm/10 min), the time spent on 9 internal and 16 outer arena squares.
2.3.2. Forced swim test (FST)Forced swim test was performed according to the modified protocol described here (Slattery and Cryan, 2012). During the pretest (Day 1), rats were placed individually into the swimming cylinder (1.0 m height, 0.3 m diameter, with 0.5 m of warm water, +25°C) and left to swim for 15 min, then removed from water, dried with a towel and returned to the home cages. Twenty-four hours after the pre-test, the rats were individually forced to swim inside a vertical Plexiglas cylinder containing 0.5 m of water (+25°C). The camera was placed directly above the swimming cylinder and video recording was started before the rats were placed into the cylinder. After 5 min in the water, the rats were removed and allowed to dry for 20 min before being returned to their home cages. In the subsequent analysis, we defined the times for “immobile” (immobility), “mobile” (swimming), and “highly mobile” (climbing) behavior.
2.3.3. Elevated plus maze (EPM)The EPM apparatus consisted of two opposite open arms (0.5 m × 0.1 m) and two closed arms (0.5 m × 0.1 m × 0.4 m) raised to a height of 0.5 m above the floor. The junction area of the four arms (central platform) was 0.1 m × 0.1 m. Lighting in the maze was 30 lx. For the EPM test, each animal was placed on the central platform of the maze facing one of the open arms. Total distance traveled, number of open arm entries, and time spent in open arms were assessed over a 5-min period. In the EPM, anxiety levels were measured by comparing the amount of time spent in the open arms to total time.
2.3.4. Contextual/Cued fear conditioning test 2.3.4.1. Conditioning apparatusA conditioning box (45 cm × 45 cm × 40 cm; custom-made) with an electric grid floor was located in a sound-attenuating chamber (50 cm × 80 cm × 60 cm) to reduce external noise and visual stimulation. After each test, the conditioning box was cleaned with water containing a small amount of neutral-smelling detergent. The behavior of the rats was recorded through the side wall of the conditioning box with a camera attached to the inner roof of the chamber. The light, tone, and foot shock in the conditioning box were controlled by the custom-made software.
2.3.4.2. Contextual/Cued fear conditioning procedureThe contextual/cued fear conditioning test was performed for three consecutive days as reported previously, with some modifications (Bogovyk et al., 2017). One day prior to fear-conditioning learning (Day 1), each rat was habituated to the experimental chamber for 10 min. On Day 2 (training day), the animals were placed in the same chamber for contextual fear-conditioning training. After 60 s of free exploration, an auditory tone cue (70 dB, 10 kHz, 20 s) was presented followed by a mild foot shock (0.5 mA, 0.5 s), three tone-foot shock pairings with a 2-min interstimulus interval were applied. After the shock, the animal remained in the experimental chamber for another 60 s. On Day 3 (24 h after the previous session; testing day), the rats were subjected to a similar procedure, except that the foot shock was not given. Duration of freezing (no movement for at least 1 s) was measured during the last 20 s before the onset of an auditory tone (contextual fear conditioning) and during the tone (cued fear conditioning) twice, on the training and testing days. Spontaneous freezing refers to freezing within 20 s before the onset of an auditory tone during the training session.
2.4. Histological assessment of the structure of hippocampus, prefrontal cortex, cerebellum, and thalamusFor histological examination, rat brains were fixed in 10% formalin solution in cold 0.1 M phosphate-buffered saline (PBS, pH 7.4), dehydrated in increasing concentrations of ethanol, and embedded in paraffin (Leica-Paraplast Regular, 39601006, Leica Biosystems Inc., USA) according to the standard procedure. Paraffin sections 5 μm thick were prepared on a Thermo Microm HM 360 Rotary microtome (Microm GmbH, Germany). Sections were deparaffined in xylene and then rehydrated in decreasing concentrations of ethanol (100%, 95%, 80% and 70%) and distilled water, followed by staining for 5 min with 0.05% toluidine blue (pH 4.5) using the Nissl technique (García-Cabezas et al., 2016) or hematoxylin and eosin (H&E; 3 min for hematoxylin and 45 s for eosin). Ten sections from hippocampus, prefrontal cortex, cerebellum, and thalamus of each animal were taken in a systematic randomized manner and covered with Histofluid coverslips (6900002, Paul Marienfeld EN, Germany). The sections were examined under a light microscope (Olympus BX 51, Japan) at ×400 magnification. Digital photographs were taken using CarlZeiss software (AxioVision SE64 Rel.4.9.1). The cells with morphological signs of cytolysis, hyperchromatosis, karyolysis, and karyopyknosis were considered affected.
2.5. Synaptosome preparation and isolation of synaptic vesicles from rat brainPurified synaptosomes were obtained from Wistar rat brains by the differential centrifugation (Kasatkina et al., 2018) using Ficoll-400 density gradient centrifugation of crude samples. Synaptosomes were used within 2–4 h after isolation.
Synaptic vesicles (SVs) were isolated from the cerebral hemispheres according to the following method (De Lorenzo and Freedman, 1978). Crude (unpurified) synaptosomes were lysed with a buffer containing 1 mM EGTA, 10 mM Tris-HCl, pH 8.1 (3 ml/g of brain tissue) and then incubated at +4°C for 60 min. The samples were centrifuged at 20,000 g for 30 min, followed by the next supernatant centrifugation step at 55,000 g for 60 min. The last centrifugation step was carried out at 130,000 g (+4°C, 60 min) to obtain the SVs fraction (pellet) and the synaptosomal fraction of cytosolic proteins (supernatant). The SV pellet was resuspended in 10 mM Tris-HCl (pH 7.5). The purity of the SV fraction was assessed by measuring the activity of Na+/K+-ATPase, a plasma membrane marker that was not detected in the purified SV fraction.
2.6. Depolarization-induced exocytosis from isolated nerve terminalsThe isolated synaptic terminals (synaptosomes) were preincubated at +37°C for 10 min and fluorescence (F) was measured on a Hitachi 650-10S spectrofluorimeter (Japan) at excitation and emission wavelengths of 490 and 530 nm (2 nm slit), respectively. High K+ (35 mM) depolarization of the plasma membrane was achieved in Ca2+-containing medium at the steady-state of acridine orange (AO) fluorescence. The traces were normalized to the similar data in the absence of synaptosomes:
F=Ft/F0,
where F0 is the fluorescence intensity measured upon AO quenching in the solution, and Ft is the fluorescence intensity of AO in the presence of synaptosomes.
2.7. Synaptic vesicle fusion with plasma membranes in cell-free systemWe employed the octadecyl rhodamine B chloride (R18) technique to detect SV fusion with target synaptic plasma membranes. The fusion was recorded on a Hitachi 650-10S spectrofluorimeter (Japan) in a suspension of R18-labeled SVs (1 nmol/240 μg of synaptosomal protein) and unlabeled plasma membranes in a ratio of 1:8 (according to protein concentration) after addition of Ca2+ (Trikash et al., 2010). An increase in the fluorescence signal was recorded as a result of membrane fusion and R18 dequenching. To quantify the probe dilution during the fusion of vesicles with target membranes, the initial fluorescence signal of R18-labeled SVs (Io) was measured. The time-dependent dequenching of the fluorescence signal (I) was recorded within 4 min after the start of testing. At the end of each experiment, C12E8 detergent was added to the reaction mixture at a final concentration of 0.1%, at which the maximum value (Id) of the dequenched fluorophore signal was obtained. The fusion rate at any given time is proportional to the percentage of fluorescence dequenching (%FD) and thus can be calculated as:
%FD=100(I-Io)/(Id-Io)
2.8. Electrophysiology 2.8.1. Isolation of the rat hippocampal sections and slice preparationFor electrophysiological studies, experimental rats were deeply anesthetized with diethyl ether followed by decapitation. The brain was carefully removed from the skull and placed in a Petri dish filled with an ice-cold solution of oxygenated (95% O2, 5% CO2) artificial cerebrospinal fluid (ACSF) solution (119 mM NaCl, 2.5 mM KCl, 2.0 mM CaCl2, 1.3 mM MgCl2, 26 mM NaHCO3, 1.0 mM NaH2PO4, 11 mM glucose, pH 7.35). The cerebellum was dissected with a surgical blade and a median sagittal incision was made separating the cerebral hemispheres. The hippocampus was carefully separated from the surrounding tissues and placed in a pre-prepared agar block (3.7% agar). The agar blocks with hippocampi were glued to the surface of a vibrotome plate (SYS-NVLS, World Precision Instr., USA) to ensure its reliable fixation during sectioning. The slice thickness was 400 μm. After preparation, hippocampal sections were placed in an incubation chamber with oxygenated ACSF (+26°C) for 1.5–2 h.
2.8.2. Electrophysiological studiesExtracellular recordings were performed on freshly isolated slices of the hippocampus. The slices were transferred to a submersion-type thermostatic chamber (Warner Instrument Corp., USA), where the sections were continuously perfused with oxygenated ACSF at a rate of 2–4 ml/min (+30–32°C). The stimulating and recording electrodes were placed on the slice surface at a distance of approximately 400 μm from each other. The synaptic response was induced by stimulating the Schaffer collaterals using a concentric bipolar stimulating electrode and an isolated stimulation unit (ISO-Flex, AMPI, Israel). Recording of the extracellular field potential (fEPSP) was performed from the hippocampal CA1 striatum radiatum layer using glass microelectrodes (resistance of 1–3 MΩ when filled with ACSF) and a patch-clamp amplifier (RK-400, Bio-Logic Science Instruments, Grenoble, France). Recordings were digitized using an analog-to-digital converter (NI PCI-6221, National instruments, Austin, TX, USA) and stored on a computer running WinWCP software (Strathclyde Electrophysiology Software, University of Strathclyde, Glasgow, UK). For the baseline recording (0.33 Hz for 10 min), the stimulus intensity was set to elicit field excitatory postsynaptic potential (fEPSP) that was approximately 30–40% of the maximum response. To induce long-term plasticity (LTP), high-frequency tetanic stimulation (HFS) of 100 pulses at a frequency of 100 Hz was delivered at a baseline stimulation intensity. LTP was assessed by averaging the synaptic response from 30 to 40 min after HFS. LTP studies were carried out on 12 slices (7 animals) in the control group, 12 slices (6 animals) in the prednisolone-supplemented group, and 12 slices (5 animals) in the VD3-supplemented group. No more than three slices per animal were used. Offline data analysis was performed using Prism 6 (GraphPad, La Jolla, CA, USA), and Origin 7.5 (OriginLab, Northampton, MA, USA) software. Statistical comparison of changes in synaptic response was performed by measuring the initial slope of fEPSP. For LTP analysis, data from each experiment were normalized to baseline.
2.9. RNA isolation and real-time PCRTotal RNA was isolated from rat brain using the innuPREP RNA Mini Kit (Analytik Jena AG, Germany). The mRNA concentration was determined on a DS-11 Spectrophotometer/Fluorometer (DeNovix, USA). The Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc., USA) was used to synthesize cDNA samples for subsequent RT-PCR on a Standard real-time PCR Thermal Cycler (Analytik Jena AG, Germany). Specific primer sequences for Vdr, Vdbp, Cyp27b1, Cyp24a1, Nf-κb, Iκb-alpha, and the glyceraldehyde 3-phosphate dehydrogenase (Gapdh) reference gene were designed using Primer BLAST software and used at a working concentration of 10 μM:
Gene Forward 5′→3′ Reverse 5′→3′ Vdr TCATCCCTACTGTGTCCCGT TGAGTGCTCCTTGGTTCGTG’ Vdbp AAACCCTTAGGGAATGCTGC TTTTGTCCTCAGTCGTTCCG Cyp27b1 TGGGTGCTGGGAACTAACCC TCGCAGACTGATTCCACCTC Cyp24a1 TTCGCTCATCTCCCATTCGG TTGCTGGTCTTGATTGGGGT Gapdh TGAACGGGAAGCTCACTGG TCCACCACCCTGTTGCTGTA Nf-κb GTACTTGCCAGACACAGACGA CTCGGGAAGGCACAGCAATA Iκb-alpha TGAAGTGTGGGGCTGATGTC AGGGCAACTCATCTTCCGTGTarget genes were amplified for 60 cycles using Maxima SYBER Green/ROX qPCR Master Mix (Thermo Fisher Scientific Inc., USA). Relative mRNA expression calculations were performed according to the 2–ΔΔCt comparison method. The expression level of each gene was normalized for GAPDH in the same samples and then calculated as a fold change compared to the control.
2.10. Western blot analysisUsing Western blotting, we measured the following protein levels in total brain tissue lysates. First, VDR was examined to evaluate the effect of chronic administration of prednisolone on the main component of the vitamin D auto/paracrine system. 3-Nitrotyrosine, carbonylated and poly(ADP)-ribosylated proteins (PAR), as well as PARP-1 attracted our attention as reliable markers of oxidative-nitrosative and genotoxic stress in brain tissue. Finally, the glucocorticoid receptor (GR), NF-κB p65 phosphorylated at Ser311, and IκB were measured to characterize the relationship of VDR and GR with NF-κB transcriptional activity. Total protein extracts were prepared from frozen brain tissue according to a standard protocol using RIPA buffer (20 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1% Triton X-100; 1 mM EGTA; 0.1% SDS; 1% sodium deoxycholate; 10 mM sodium pyrophosphate) and a protease inhibitor cocktail (PIC, Sigma, USA), and then the samples were sonicated and centrifuged. The supernatants were stored at −80°C until required. Lysate samples containing 60 μg of protein were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using a 10–15% gel followed by protein transfer to a nitrocellulose membrane. The membrane was then blocked for 1 h with 5% skimmed milk diluted in Tris-buffered saline with Tween (TBST, 150 mM NaCl, 10 mM Tris-HCl, and 0.1% Tween; pH 7.5) and incubated overnight at +4°C with one of the following primary antibodies (VDR: 1:200, sc-13133, Santa Cruz; 3-nitrotyrosine: 1:2,500, #05-233, Merck Millipore; carbonylated proteins: 1:1,000, ab-178020, Abcam; poly(ADP)-ribosylated proteins: 1:1,000, 4335-MC-100_AC, Trevigen; PARP-1: 1:1,000, #9542, Cell Signaling; GR: 1:250, sc-1004, Santa Cruz; NF-κB p65 phosphorylated at Ser 311: 1:200, sc-33039, Santa Cruz; and IκB-α: 1:1,000, sc-847, Santa Cruz). Subsequently, the membrane was thoroughly rinsed and incubated for 1 h with secondary antibodies: anti-rabbit IgG (H + L)-HRP conjugate (1:4,000, #1721019, Bio-Rad) or anti-mouse IgG (Fab Specific)-Peroxidase (1:2,500, A9917, Sigma) at room temperature. Thereafter, the membrane was developed with chemiluminescent agents: p-coumaric acid (Sigma, USA) and luminol (AppliChem GmbH, Germany). Target protein immunoreactive signals were quantified by densitometry and values were adjusted for the corresponding β-actin level (1:10,000, A3854, Sigma). Immunoreactive bands were quantified using Gel-Pro Analyzer v3.1 software.
2.11. ELISA 25-hydroxyvitamin D3 assayUsing a commercial ELISA kit ≪25-OH-Vitamin D3≫ (Immunodiagnostics, Germany), in accordance with the manufacturer’s instructions, the VD3 status was assessed by determining the concentration of 25-hydroxyvitamin D3 in the serum, cerebrospinal fluid and brain homogenate of rats. Cerebrospinal fluid was obtained by puncture of the atlanto-occipital space. Brain homogenates were prepared from frozen brain tissue (100 mg) that was ground in a porcelain mortar with liquid nitrogen, lysed in PBS with 1% Tween-20 (pH 7.4), then sonicated and incubated on ice for 2 h. Next, the samples were centrifuged at 14,000 g for 20 min at +4°C. The supernatant was carefully collected and aliquots were stored at −20°C avoiding thawing/freezing.
2.12. StatisticsThe results of all experiments were expressed as the mean ± standard deviation for at least seven rats per group. The hypothesis about the normality of data distribution was tested using the Shapiro–Wilk test. Differences between means were estimated using the ANOVA followed by Tukey’s post hoc test. To compare difference between groups in neuronal morphometric parameters, statistical significance was determined using a two-tailed unpaired Student’s t-test. For behavioral data, the non-parametric Kruskal–Wallis test was used, if necessary, followed by Dunn’s post hoc test. The significance criterion was p ≤ 0.05. Statistical analysis was performed using Origin Pro 8.5 software (OriginLab Corporation, Northampton, MA, USA). For behavioral datasets, statistical significance was analyzed using the Origin 9 and Graph Pad Prism 6 software.
3. Results 3.1. Effect of prednisolone and vitamin D3 on brain-to-body weight ratioThe brain-to-body weight ratio is commonly used in neurotoxicity studies to estimate the presence of general morphopathological changes in the brain. As can be seen from Table 1, the administration of prednisolone slowed down the growth of rats and reduced the average body weight by 70.65% compared with the control group (Tukey’s test, p = 0.000051), while there was no significant difference in the average brain mass between the two groups (Table 1, Tukey’s test, p > 0.05). An assessment of the brain-to-body weight ratio revealed that GC slightly increased it by 29.04% compared with the control group (Tukey’s test, p = 0.0031). Treatment with VD3 enhanced mean body weight by 15.97% compared with the prednisolone group (Tukey’s test, p = 0.033), however, it did not lead to any ameliorative effect on the brain-to-body weight ratio compared with the prednisolone group (Tukey’s test, p > 0.05).
Table 1. Effect of prednisolone and vitamin D3 administration on brain-to-body weight ratios in rats (M ± m, n = 20).
3.2. Vitamin D3 status and the state of VD3-auto/paracrine system in brain after prednisolone administration and effect of vitamin D3 treatmentIn the context of the essential role of vitamin D3 for the CNS functioning, the question arose whether chronic GC treatment could affect the circulating VD3 pool and alter the content of the main components of the VD3-auto/paracrine system. First, we measured the level of 25-hydroxyvitamin D3 as a reliable marker of VD3 bioavailability in serum, cerebrospinal fluid, and brain homogenates. Figure 2A shows a pronounced drop in 25OHD3 in the serum of rats supplemented with GC (by 3.24-fold, up to 30.00 ± 3.04 nmol/L) compared with the control animals (97.23 ± 7.01 nmol/L, Tukey’s test, p = 0.000001). In the CSF, we observed half the content of 25OHD3 in the prednisolone group (16.00 ± 2.05 nmol/L) than in the control group (33.00 ± 2.50 nmol/L, Figure 2A). Finally, depletion of the circulating VD3 pool was correlated with a significant decrease in the 25OHD3 level in the brain tissue extracts, indicating impaired bioavailability of the VD3-prohormone in the nervous tissue. Figure 2B demonstrates that the 25OHD3 level after prednisolone supplementation was 8.64 ng/g brain tissue compared to 18.60 ng/g brain tissue in the control animals, representing a 2.15-fold decrease (Tukey’s test, p = 0.022).
Figure 2. Vitamin D3 circulating pool and the state of vitamin D3-auto/paracrine system in the brain tissue. 25OHD3 concentration in the serum, cerebrospinal fluid (A) and brain homogenates (B) were measured by ELISA (n = 20). VDR protein (C,D) and mRNA (D) levels were determined by western blotting and quantitative RT-PCR respectively in rat brain tissue of three animal groups: 1—control; 2—prednisolone administration; 3—prednisolone and vitamin D3 administration (n = 8 rats/group). Representative immunoblots are shown near the bar charts (C). Cyp27b1 (E) and Cyp24a1 (F) mRNA levels were assessed by quantitative RT-PCR. All protein levels were normalized to β-actin and mRNA levels—to Gapdh expression. All data are presented as mean ± SD of three independent experiments done in triplicate; *p < 0.05 denotes significance compared with control, #p < 0.05 denotes significance compared with prednisolone administration.
Vitamin D3 supplementation caused a partial restoration of the 25OHD3 content. To a greater extent, the normalizing effect concerned the serum, where the 25OHD3 level rose to 111.43 ± 13.17 nmol/L and there was no significant difference with the control group. In the CSF, we also observed a tendency to restore the level of 25OHD3, the value of which reached 22 ± 3.1 nmol/L. This is 37.5% higher than in the prednisolone group. The 25OHD3 level also increased in the brain extract to 12.88 ± 0.9 ng/g of tissue, which was 49% higher than in the prednisolone group (Tukey’s test, p = 0.042), but remained still lower (by 44.4%) than in the control. Collectively, these data indicate a profound GC-induced VD3 deficiency and depletion of the circulating VD3 pool under the influence of prednisolone, however, vitamin D3 treatment may partially restore the circulating VD3 pool, suggesting that this abnormality is reversible.
Since the hormonally active form of VD3 in different cell types exerts its biological action through specific receptors for 1,25(OH)2D3 – VDR, we also examined the VDR expression in the brain at the transcriptional and translational levels (Figures 2C, D). It was shown that after prednisolone administration, the level of Vdr mRNA in the brain increased by 6.45 times (Tukey’s test, p = 0.000003) (Figure 2D). We further confirmed an increase in VDR protein by western blot (Figures 2C, D), which was 41% higher than in the control group (Tukey’s test, p = 0.005). In turn, a strong reducing effect of VD3 on the expression of Vdr mRNA (by 2.14-fold, Tukey’s test, p = 0.000001) and protein (by 3.44-fold, Tukey’s test, p = 0.000002) was found compared with the prednisolone group.
Despite the observed disturbances in the VDR expression, the next question arises whether prednisolone is able to affect the VD3 transport. VDBP is considered to be the major plasma transporter for all VD3 metabolites; however, its function in the brain is not fully understood. Therefore, we examined the level of Vdbp mRNA and found that prednisolone caused a 42%-lowering effect (Tukey’s test, p = 0.002) compared to the control, while VD3 supplementation restored its level to the control value (Figure 2E).
To complete this part of the study, we focused on enzymes involved in VD3 metabolism and considered important factors that contribute to the proper functioning of the VD3-auto/paracrine system. As presented in Figure 2F, prednisolone induced a significant (5.46-fold, Tukey’s test, p = 0.00002) increase in Cyp27b1 mRNA expression in the brain compared with the control animals, which may reflect a compensatory response of the VD3-auto/paracrine system to the lack of circulatory and brain levels of 25OHD3. Vitamin D3 treatment reduced Cyp27b1 gene expression to a level that was 9.72-fold lower than in the prednisolone group (Tukey’s test, p = 0.00001) and 1.79-fold lower than in the control group (Tukey’s test, p = 0.0029).
Another component of the VD3-auto/paracrine system that we examined was CYP24A1, that catalyzes the inactivation of both 25OHD3 and 1,25(OH)2D3 (Hamamoto et al., 2006). In contrast to the effect of prednisolone on Cyp27b1, this glucocorticoid caused a 5.41-fold decrease in Cyp24a1 mRNA level compared with the control group (Tukey’s test, p = 0.0005), while VD3 did not significantly affect the level of Cyp24A1 mRNA compared with the prednisolone group (Tukey’s test, p > 0.05, Figure 2F).
In general, our results suggest that, despite the development of VD3-deficiency, prednisolone elevated, most likely compensatory, the expression of such important components of the VD3-auto/paracrine system as CYP27B1 and VDR, while the levels of mRNA transcripts of CYP24A1 and VDBP genes decreased in the brain, thus indicating an impairment of VD3 transport and catabolism. Administration of cholecalciferol restored the circulating 25OHD3 pool and normalized, at least in part, the levels of key components of the VD3-auto/paracrine system in the brain, although VD3 24-hydroxylase remained unchanged.
3.3. Effects of prednisolone and vitamin D3 on depressive-like behavior, locomotion and cognitive performanceTo support the concept that VD3 deficiency may be associated with behavioral abnormalities (Schoenrock and Tarantino, 2016), we further estimated prednisolone-induced behavioral changes in animals that we found to exhibit significantly reduced VD3 bioavailability. The open-field test allows to examine motor function and exploratory behavior by measuring spontaneous activity in the OFT box. Animals of all groups showed no significant difference in walking distance (p > 0.05) and in time spent exploring 9 inner squares and 16 outer squares (p > 0.05), as presented in Figures 3A–C respectively.
Figure 3. The influence of prednisolone and vitamin D3 on the parameters of the open field (OFT) and forced swim (FST) tests. Animals from three experimental groups: 1—control; 2—prednisolone administration; 3—prednisolone and vitamin D3 administration (n = 8 rats/group) were subjected to the OFT (A–C) and FST (D–F). Total distance traveled (A), time spent in outer (B) and inner (C) zones were calculated during the OFT. Total immobility time (D) and the parameters of active behavior: swimming (E), and climbing (F) were assessed during the FST. All data are presented as mean ± SD of three independent experiments done in triplicate; *p < 0.05 denotes significance compared with control, #p < 0.05 denotes significance compared with prednisolone administration.
The forced swim test has been used to assess the presence of depression-related behaviors (Slattery and Cryan, 2012). Prednisolone-administered rats demonstrated an increase in immobility time (220 ± 15 s, Figure 3D) and a decrease in active behavior (swimming 30 ± 3 s, Figure 3E, climbing 50 ± 6 s, Figure 3F) compared with the control rats (160 ± 12 s, 60 ± 5 s, 80 ± 9 s, respectively), indicating depressive-like changes. VD3 exerted antidepressive-like action, diminishing immobility time (150 ± 11 s) and stimulating active behavior (swimming 65 ± 5 s, climbing 85 ± 8 s) compared with the GC action.
The next task was to determine the level of anxiety in the elevated plus maze test by measuring the amount of time spent in open/closed arms. Behavior in performing this task (activity in the open arms) reflects a conflict between rodent’s preference for protected areas (closed arms) and their innate motivation to explore novel environments. In the EPM test, we observed a tendency to an increased percentage of entries into the open arms (38.33 ± 5.9%, Figure 4A) and time spent in the open arms (14.92 ± 3.16%, Figure 4B) after prednisolone administration compared with the control group (21.03 ± 3.9% and 7.3 ± 1.27%, respectively). Unexpectedly, these results showed that prednisolone did not cause the anxiety-related behavioral changes. Increased time spent in the open arms and percentage of entries are conventionally interpreted as decreased anxiety-like behavior (Shoji and Miyakawa, 2021), however, another possible interpretation can be considered: an open arm study may reflect heightened anxiety and panic response to a novel situation under certain conditions. VD3 administration reduced the percentage of entries into the open arms (13.88 ± 3.4%, p = 0.0272) and time spent in the open arms (5.92 ± 2.18%, p = 0.0306) compared to the prednisolone-administered group. In addition, there was no meaningful difference when comparing the EPM parameters of VD3-treated rats with the control group and the prednisolone group. Interestingly, time spent in the open arms of the EPM was positively correlated with immobility time in the FST (r = 0.296, p < 0.05) and negatively correlated with active behavior (r = −0.382, p < 0.01 for swimming).
Figure 4. The effect of prednisolone and vitamin D3 on the behavior in the elevated plus maze (EPM) and contextual and cued fear conditioning and memory test. Animals from three experimental groups: 1—control; 2—prednisolone administration; 3—prednisolone and vitamin D3 administration (n = 8 rats/group) were subjected to the EPM (A,B) and contextual/cued conditioning test (C,D). The percentage of entries into the open arms to the total time (Op/Tot) (A) and the ratio of time spent in the open arms to the total time (Op/Tot) (B) were measured during the EPM. Mean freezing time levels during the contextual (C) and cued (D) conditioning test were assessed after prednisolone and vitamin D3 treatment during training and testing days. All data are presented as mean ± SD of three independent experiments done in triplicate; *p < 0.05 denotes significance compared with control, #p < 0.05 denotes significance compared with prednisolone administration.
After completion of the OFT, FST, and EPM tests, the rats were subjected to a contextual/cued fear conditioning test to assess an associative fear learning and memory. As shown in Figures 4C, D, there was no statistically significant difference in spontaneous freezing between all groups during the training day in the novel context (p = 0.65, Figure 4C) and after an auditory tone cue (p = 0.99, Figure 4D). We also did not observe significant differences between groups in the level of spontaneous freezing during the day of testing in both contextual and cued conditioning. However, we noted a tendency that the time of contextual conditioning freezing was significantly shorter in prednisolone-administered rats (2.63 ± 0.64 s vs. 4.44 ± 1.33 s in the control). A separate analysis of freezing time between each group revealed the statistically significant differences between training and testing days for three groups in contextual conditioning (Figures 4C, p = 0.049). However, no valuable difference was observed in cued conditioning freezing between all 3 groups (Figures 4D, p = 0.068).
Thus, we did not find any significant effects on locomotor activity or memory parameters (based on OFT and contextual/cued conditioning), while FST and EPM tests reflect the behavioral changes following prednisolone administration. In particular, FST demonstrated an increase in immobility time and a decrease in active behavior in glucocorticoid-treated rats, indicative of depressive-like changes. At the same time, the EPM results may point to the stimulation of anti-anxiety behavior induced by prednisolone; however, taking into consideration an increased time of immobility in the FST, we are more inclined to believe that the data obtained could reflect a panic-like reaction. Vitamin D3 treatment diminished the immobility time and stimulated active behavior, suggesting anti-depressive effect of cholecalciferol. Exploratory behavior in the EPM was restored to control levels after VD3 action.
3.4. Prednisolone-induced histological alterations of different brain regions and effect of vitamin D3 in their preventionBecause lesions in the hippocampus are known to be capable of disrupting contextual fear conditioning (Chen et al., 1996), and given the observed GC-induced tendency to reduce freezing time in contextual conditioning, we first assessed the presence of histopathological changes in the hippocampus. For this purpose, histological staining with toluidine blue was carried out, followed by morphometric and statistical evaluation of the CA1–CA3 regions.
Histological examination revealed no visible signs of brain damage (neither hydropic neuronal dystrophy nor neurodegeneration) in all three groups (Figure 5A). Analysis of the morphometric parameters of pyramidal neurons in fields CA1–CA3 confirmed the presence of the following changes (Table 2). The perikaryon area increased by 55.1% in CA1, by 67.6% in CA2, and by 29.0% in the CA3 region in the prednisolone group compared with the control group (Student’s t-test, p < 0.001). In addition, after prednisolone administration, we observed intact, but at the same time, enlarged neuronal nuclei (by 62.55, 83.45, and 49.27% in CA1, CA2, and CA3, respectively) compared with the control (Student’s t-test, p < 0.001). The nuclei contained increased levels of euchromatin, indicating the activation of biosynthetic processes in neurons. Prednisolone also caused a slight decreasing effect on cell density in the CA1–CA3 hippocampal fields (Figure 5A). Vitamin D3 administration led to a significant decrease in the mean areas of both the perikaryon and the nucleus in CA1 compared with the prednisolone group (by 68.12 and 73.79%, respectively, Student’s t-test, p < 0.001), while only a slight tendency to a reduction of these parameters in CA2 and CA3 sections was found.
Figure 5. Histological examination of hippocampus, cerebral cortex, thalamus and cerebellum after prednisolone and vitamin D3 treatment (toluidine blue or hematoxylin & eosin staining). Representative images of toluidine blue-stained 6-μm rat CA1 hippocampal sections section (A), H&E-stained cerebral cortex (prefrontal cortex) (B), sensory-motor cortex (C), H&E-stained thalamus sections (posterior thalamic nucleus) (D), and H&E-stained cerebellar cortex (E) from the control, prednisolone-administered and prednisolone plus vitamin D3-administered rats (n = 5 rats/group, 400× magnification).
Table 2. Morphometric parameters of hippocampal neurons of CA1-CA3 fields (M ± m, n = 5).
Histological sections of the cerebral cortex demonstrate the preservation of the general morphological structure of the prefrontal and sensorimotor cortex (Figures 5B, C). In all studied samples, pyramidal neurons and glial cells were detected in all layers of the cerebral cortex, except for the molecular layer. Structurally intact microvessels, mostly hemocapillaries, were also present. We did not reveal any signs of inflammation, leukocyte infiltration, necrosis or hemorrhage (Figures 5B, C). However, in the groups of prednisolone and VD3, clarification of the cytoplasm was observed in large pyramidal neurons, especially in the ganglionic cell layer, probably indicating impaired functional activity of cells, inhibition of synthetic processes, and disintegration of organelles of the protein-synthesizing apparatus of neurons. We did not detect a statistically significant difference in the number of neurons in the prefrontal and sensorimotor cortex between the studied groups (Table 3). When comparing the mean area of neurons in the ganglionic layer of the cerebral cortex, there was a tendency to its increase in the prefrontal cortex after prednisolone administration compared with the control (by 13.4%, Student’s t-test, p = 0.04). In the sensorimotor cortex, a trend toward an increase in the mean area of neurons was found after VD3 treatment compared with the control (by 18.1%, Student’s t-test, p = 0.03) and prednisolone (by 24.1%, Student’s t-test, p = 0.035) groups.
Table 3. Morphometric parameters of the cerebral cortex (test area 550 μm × 215 μm, M ± m, n = 5).
Next, we studied the effect of prednisolone and cholecalciferol on the posterior thalamic nucleus. Histological evaluation did not reveal signs of dystrophic changes, necrosis or inflammation in the thalamus of all experimental groups. We also did not detect neuronal necrosis, however, single hyperchromic gliocytes and neurons were found. In general, the histological structure of the thalamic region in all the studied groups was similar (Figure 5D). These observations were confirmed by morphometric analysis, and there was no statistically significant between-group difference, as indicated in Table 4.
Table 4. Morphometric parameters of the thalamus (posterior thalamic nucleus, test area 550 μm × 215 μm, M ± m, n = 5).
Finally, we found a number of morphological changes in the cerebellar cortex caused by the prednisolone action, with a slight ameliorative effect of VD3. In general, for all experimental groups the cytoarchitecture of the cerebellar cortex was well preserved; the molecular, ganglionic, and granular layers were clearly visible (Figure 5E). In the molecular layer, single nuclei of gliocytes and processes of neurons were detected, which together formed the outer layer of the cerebellar cortex. Separate piriform neurons (Purkinje cells) in the ganglionic layer were located in a one-layered manner. The granular layer was formed by numerous small granular neurons. Thus, we did not find any neurodystrophic changes in the molecular and granular layer after prednisolone administration, while in the ganglionic layer there were strained neurons with hyperchromic staining of the cytoplasm and nuclei. Although we did not observe intergroup differences in the number of neurons and density of Purkinje cells in the cerebellar cortex (Table 5), the size of strained neurons was 43.2% and 33.2% smaller in the prednisolone group (406.1 ± 14.7 μm2, Student’s t-test, p = 0.009) and after VD3 treatment (477.7 ± 27.8 μm2, Student’s t-test, p = 0.012), respectively, compared with the control group (714.9 ± 48.3 μm2). These observations indicate that neurodegenerative changes may occur under the influence of prednisolone in the cerebellar cortex.
Table 5. Morphometric parameters of the ganglionic layer of the cerebellum (test area – width of the cortex layer 500 μm, M ± m, n = 5).
Thus, we did not establish any valuable differences in the cytoarchitectonics of the cerebral cortex and the posterior nucleus of the thalamus between the studied groups. However, GC-induced changes were found in the hippocampus and cerebellum, namely, a decrease in cell density in the hippocampal zones, as well as a decrease in the size of neurons in the cerebellar cortex. These changes in general may indicate the onset of neurodegenerative changes under the influence of prednisolone. Vitamin D3 partially normalized the cytoarchitecture of the hippocampus and cerebellum.
3.5. Assessment of synaptic function after prednisolone administration and effect of vitamin D3 treatmentIt is most likely that despite the absence of striking prednisolone-induced histopathological changes in the brain structures they, nevertheless, can be accompanied to some extent by impaired neuronal function. The harmful effects of GC on the brain and the impact of vitamin D3 therapy may primarily concern some important aspects of synaptic function, such as depolarization-induced exocytosis from isolated neurons, synaptic vesicle fusion with plasma membrane of nerve terminals and changes in long-term potentiation (LTP).
First, we characterized the process of depolarization-induced exocytosis from isolated neurons and monitored vesicle-to-membrane fusion. As shown in Figures 6A, B, following high K+-depolarization, the nerve endings isolated from the brain of prednisolone-administered rats demonstrated a 57.5%-decrease in exocytosis amplitude compared with the control (Tukey’s test, p = 0.00023).
Figure 6. Glucocorticoid-induced disturbances of synaptic function and its correction by the vitamin D3 supplementation. Depolarization-induced exocytosis in rat brain nerve terminals (synaptosomes) (A) and quantification of the mean amplitude Δ (B). Nerve terminals were isolated from the control, prednisolone-treated and prednisolone plus vitamin D3-treated rats. Spectrofluorimetric registration of pH-sensitive dye – acridine orange (AO), n = 4. The rate of synaptic vesicle fusion with plasma membranes in cell-free system (C). Fusion was determined by monitoring of R18 fluorescence dequenching in suspension of R18-labeled synaptic vesicles and unlabeled synaptic plasma membranes upon Ca2+ application in control and prednisolone-administered rats, n = 5 (traces). Cholesterol content in synaptic plasma membranes (D) of control and prednisolone-treated rats (n = 5). All data are presented as mean ± SD of three independent experiments done in triplicate; *p < 0.05 denotes significance compared with control, #p < 0.05 denotes significance compared with prednisolone administration.
One of the reasons for the decrease in the exocytosis amplitude might be changes in the mechanisms involved in providing the fusion of synaptic vesicles with the plasma membranes of synaptic terminals. This process strictly depends on the presence of soluble cytosolic synaptic proteins and involves successive stages of interaction of synaptic vesicles with the target membrane: docking, priming, and fusion. We isolated synaptic vesicles and synaptic plasma membranes and evaluated their Ca2+-triggered fusion in a cell-free system. As is seen in Figure 6C, synaptic vesicles from prednisolone-administered rats show a significantly lower rate of Ca2+-dependent synaptic plasma membrane fusion (by 29.53%) compared to the control (Tukey’s test, p = 0.01).
Glucocorticoids have been reported to impair cholesterol metabolism in the brain, and its level is one of the important factors influencing the rate of synaptic vesicle fusion with each other and with the synaptic plasma membrane (Gumenyuk et al., 2013). With this in mind, we studied the content of total cholesterol in synaptic membranes isolated from the cerebral hemispheres and found an increase in its level in prednisolone-supplemented animals (0.81 ± 0.07 μmol/mg protein) compared to the control level (0.65 ± 0.05 μmol/mg protein) (Figure 6D). Elevated synaptic plasma membrane cholesterol may indicate abnormal cholesterol metabolism associated with the administration of prednisolone and
留言 (0)