Animals

Establishment of the EpA960/CaMKII-Cre line has been described previously [11]. Animals in the C57BL6 background were maintained on a standard 12-h light/dark cycle with the light on at 8:00 AM. Food and water were available ad libitum. Brain samples used for protein extraction were obtained from littermates of both genders. All animal experiments were performed with the approval of the Academia Sinica Institutional Animal Care and Utilization Committee (IACUC, Academia Sinica, Taiwan).

Human postmortem brain samples

All postmortem brain tissues, i.e., three DM1 and three age-matched non-DM1 human brains (four males and two females), were obtained from the NICHD Brain and Tissue Bank for Developmental Disorders (University of Maryland, MD, USA). Frozen tissues were subjected to biochemical fractionation, or underwent cryo-sectioning at 10-µm thickness for immunofluorescence staining and in situ hybridization. The protocol was approved by the Institutional Review Board, Academia Sinica, Taiwan.

Primary hippocampal neuron culture and transfection

Rat hippocampal neurons were dissociated from embryos at embryonic day 18–19 as described [7]. Briefly, hippocampal tissues were trypsinizied with 0.5X trypsin in Hank’s buffered salt solution, resuspended in growth medium (neurobasal medium supplemented with 2% B27 supplement, 0.5 mM glutamine, and 12.5 mM glutamate), and plated in 12-well plates containing glass coverslips coated with poly-L-lysine (1 mg/ml) at 200,000 neurons per well to examine the morphological features of axons. Transfection was performed at day 2 or 3 of in vitro culture (DIV) to assess axonal outgrowth by calcium phosphate precipitation. Two to three days after transfection (i.e., 5 DIV), neurons were harvested for morphological assessment based on their co-expression of GFP plasmid.

Immunofluorescence, immunohistochemistry, fluorescence in situ hybridization and quantification

For immunofluorescence staining, cells were fixed with 4% PFA and 4% sucrose in PBS for 15 min at room temperature 2–3 days after transfection, followed by permeabilization with 0.2% Triton X-100 in PBS for 15 min. After blocking with 3% normal goat serum (NGS), cells were incubated with primary antibodies diluted in PBS containing 1% NGS at 4 °C overnight, followed by PBS washes. The cells were then incubated with secondary antibodies conjugated with Alexa Fluor 488 and/or 594 (Invitrogen) for 2 h.

To detect RNA foci on postmortem human brain sections, fluorescence in situ hybridization was performed as described [7, 11]. Briefly, sections were post-fixed with 4% PFA in PBS, followed by UV cross-linking, permeabilization, DNase treatment, prehybridization, and hybridization with Cy3-labeled (CAG)7 LNA probe at 42 °C for 2 h. For the colocalization of MBNL1 foci with RNA foci, after in situ hybridization, sections were incubated in blocking solution (3% NGS in 1X PBS containing 0.02% Triton X-100) for 1 h at room temperature, and incubated with anti-MBNL1 and anti-MAP2 antibodies. After washing, sections were incubated with secondary antibody conjugated with Alexa Fluor 488 and 647 (Invitrogen). Fluorescent images were acquired under a fluorescent microscope (AxioImager M2, Carl Zeiss) equipped with a 20x/0.8 or 40x/0.75 objective lens or a confocal laser scanning microscope (LSM700, Carl Zeiss) equipped with a 40x/1.4/oil objective lens or a 63x/1.4/oil objective lens.

For immunohistochemistry, vibratome sections collected from mouse brains were used as described with modifications [11]. Briefly, brain sections were treated with 3% H2O2 to remove endogenous peroxidase activity, followed by permeabilization, blocking and incubation with primary antibody. After wash, sections were incubated with biotinylated secondary antibody (Vector Laboratories) for 2 h, then with ABC reagent (Vector Laboratories) for 2 h, followed by signal development using the SG substrate kit (Vector Laboratories). Sections were dehydrated and cleared by xylene, and cover-slipped with permount medium (Vector Laboratories). Images were acquired under a upright microscope (BX51, Olympus) equipped with a 10x/0.4 or 20x/0.75 objective lenses.

To quantify neuronal morphology, the lengths of all axonal branches were determined in ImageJ v.1.45 (NIH) to represent total axon length. All plots show data from three independent transfections, with 15–30 neurons assessed for each transfection. To examine the distribution of TrkB receptor in mouse brain, we first defined proximal neurite region that includes soma region and neurite extended from soma in 100 µm length. We then measured the intensity of TrkB immunoreactivity in the proximal neurite region of neurons in cortical layer V. For each animal, 5–6 image frames and 20 neurons were collected. To quantify the TrkB immunoreactivity in postmortem human brain sections, only the intensity in the cell body region was measured.

Plasmids

The Mbnl1-specific shRNA clone (pLKO_219085, TGACAGCACAATGATTGATAC) and Dynll2-specific shRNA clone (pLKO_71774, GAAGGACATTGCTGCCTATA) targeting mouse MBNL1 and DYNLL2, respectively, were purchased from the RNAi Core Facility of Academia Sinica (Taiwan). Plasmids expressing Dmpk exons 11–15 with no CUG repeats (Dmpk-CUG0) or with 960 interrupted CTG repeats (Dmpk-CTG960) [19] were kindly provided by Dr. Thomas Cooper (Baylor College of Medicine, Houston, TX). The fluorescence tag-conjugated DYNLL2 and MBNL1 plasmids were subcloned in-house.

BDNF treatment

To determine the responses of neurons expressing Dmpk-CUG960 mRNA to BDNF treatment, they were transfected at 3 DIV and then treated 1 day later with BDNF (100 ng/ml, Peprotech) for 24 h before undergoing morphological analysis [20]. To determine the effect of MBNL1 or DYNLL2 knockdown on BDNF responses, cultured hippocampal neurons were transfected at 2 DIV and incubated for a further 2 days (4 DIV), before being treated with BDNF for another 24 h prior to characterization. For live-cell recording, treated with BDNF prior to the recording for 30 min at 5 DIV.

Antibodies

Antibodies used included anti-GFP (A11122, 1:1000, Invitrogen) to label transfected cells and neuronal morphologic features. The antibodies used for Western blot analyses include: anti-BDNF (ab108319, 1:3000, Abcam), anti-FLAG M2-peroxidase conjugated (1:20,000, Sigma), anti-GFP-peroxidase conjugated (clone 3D8A1B8, 1:10,000, Abking), anti-MBNL1 polyclonal antibody (ABE241, 1:1000, Millipore) [21], anti-DIC (dynein intermediate chain)(ab23905, 1:1000, Abcam), anti-DYNLL2 (Merck, ABT140), anti-PSD95 (post-synaptic density 95, clone 3H4.3, 1:2000, Millipore), anti-synaptophysin (S5768, 1:1000, Sigma), anti-TrkB (#4603, 1:1000, Cell Signaling), anti-phospho-TrkB (Y817) (MA5-32,207, 1:1000, Invitrogen), anti-HSP90 (heat shock protein 90, a gift from Dr. Yi-Ping Hsueh, 1:2000) and anti-GAPDH (MAB374, 1:20,000, Millipore). Anti-GFP antibodies (clones 19C8 and 19F7) used in immunoprecipitation were from Memorial Sloan-Kettering Monoclonal Antibody Facility. To detect the level of BDNF, the nitrocellulose membrane underwent antigen retrieval to boost the signal [22].

Subcellular fractionation of mouse and postmortem human brains

The cortices and hippocampi from adult mouse brains (3 months old, C57B6/J) or the brains of different mouse genotypes (control and EpA960/CaMKII-Cre, 1 to 1.5 years old) were collected for subcellular fractionation as described previously [23]. The frozen tissues were dounced in lysis buffer (320 mM sucrose, 4 mM HEPES, 2 mM DTT, 2 mM MgCl2, 1 mM EDTA, and proteinase inhibitor) and collected as homogenate (H), before undergoing centrifugation at 800 g to remove nuclei and other large debris (P1). The supernatant was centrifuged at 9,200 g to obtain a crude synaptosomal fraction (P2), which was then lysed with hypotonic buffer and centrifuged at 25,000 g to pellet a synaptosomal membrane fraction (LP1). The supernatant (LS1) was then centrifuged at 165,000 g to obtain a crude synaptic vesicle fraction (LP2) and a soluble fraction (LS2). The supernatant above the P2 fraction (S2) was then centrifuged at 165,000 g to obtain a cytosolic soluble fraction (S3) and a light membrane fraction (P3). A total of 5 µg of protein extract from the LP1, LP2, and LS2 fractions and 20 µg of protein extract from each fraction were subjected to Western blot analysis. The frozen human brain tissues were sliced into 0.5 cm3 pieces and then underwent the same procedure as described above for mouse brains.

Live-cell imaging

For time-lapse imaging of hippocampal neurons, cells were plated on 30 mm-diameter glass-bottom dishes (WillCo-dish) at 200,000 neurons per well. To examine the mobility of MBNL1ΔEx5 or the effect of MBNL1 knockdown on DYNLL2 mobility, transfection was performed at 4 DIV, followed by time-lapse recording 1 day later. Time-lapse imaging was performed using a confocal microscope (Zeiss) equipped with a 37 °C incubator and 5% CO2 supply. Images were taken every 2.5 s for 20 min and analyzed in MetaMorph software. Kymograph analysis was conducted on a 100 μm-extent of primary axon located at least 80 μm from the soma. The movement events and movement types of MBNL1-mCherry or DYNLL2-mCherry in MBNL1-depleted neurons were determined by kymograph [24].

Immunoprecipitation

To evaluate the interaction between MBNL1 and DYNLL2 or TrkB, cell lysates were prepared as described previously [25] with a minor modification. In brief, Neuro2A cells expressing FLAG-MBNL1 and GFP-DYNLL2 or EGFP-TrkB for 48 h were harvested in lysis buffer (25 mM Tris–HCl pH8.0, 50 mM NaCl, 0.5% Triton X-100, 5 mM DTT with protease inhibitors). The protein lysate was separated into two vials and 1 µl RNase was added into one of the vials and incubated at 37 °C for 1 h. Taking 1/10 of the protein lysate as input, the remainder was incubated overnight at 4 °C with agarose beads conjugated with 50 µg anti-GFP antibody or 1 µg anti-FLAG antibody. Proteins were eluted by adding SDS electrophoresis sample buffer (75 mM Tris–HCl pH 6.8, 3% SDS, 0.1% bromophenol blue, 15% glycerol, 40 mM DTT) and incubated at 55 °C before undergoing SDS-PAGE.

Statistical analysis

Data are presented as means ± SEM and were analyzed in SigmaPlot 12.5 (Systat Software Inc.). To compare two groups, unpaired two-tailed Student’s t-tests were used. For comparison of more than two groups, one-way ANOVA tests were used, followed by Holm-Sidak multiple comparison tests. Test results with a P value of < 0.05 were considered statistically significant. No statistical methods were used to pre-determine the sample size. Data collection and analyses were not conducted blind. The experiments using mouse and patient tissues were not randomized. Only for each independent transfection in cultured neurons were cells on coverslips randomly allocated to subject for transfections.