Cell lines and cell culture

HeLa, HEK293, HEK293 Flp-In T-REx-nsP3, -nsP3-macro, -PARP10, -PARP10-G888W [17], -PARP12, and -PARP12-H564Y cells were cultivated in DMEM supplemented with 10% heat-inactivated fetal calf serum (FCS) at 37 °C in 5% CO2. All HEK293 Flp-In T-REx cell lines were additionally supplemented with 15 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen) for selection during every second passage. After thawing cells were regularly tested for mycoplasma by first purifying genomic DNA with the peqGOLD tissue DNA Mini Kit (peqlab) according to the manufacturer’s instructions and then a PCR reaction was performed for detection of mycoplasma DNA with specific primers (GPO-1: 5’-ACTCCTACGGGAGGCAGCAGTA-3’, MGSO: 5’-TGCACCATCTGTCACTCTGTTAACCTC-3’).

Plasmid DNA transfection of cells was performed using the calcium phosphate precipitation technique. Cells were transfected 48 h after seeding and 24 h prior to transfection with in vitro transcribed replicon RNA.

Cells were transfected with in vitro transcribed replicon RNA using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. In short, cells were seeded in 12 well plates. For transfection 3 µg of in vitro transcribed RNA were dissolved in 100 µl OptiMEM and 5 µl of Lipofectamine 2000 were added, vortexed and incubated at room temperature for 5 min before adding dropwise to the cells. 100 µl of supernatant were collected 6, 9, 12, 24 and/or 30 h post transfection (hpt) for analysis of Gaussia luciferase activity. 30 hpt cells were used for flow cytometry analysis or lysed in RIPA buffer (10 mM Tris, pH 7.4; 150 mM NaCl; 1% NP-40; 1% DOC; 0.1% SDS; Protease inhibitor cocktail (PIC)), fractionated by SDS-PAGE and subjected to immunoblotting.

To mediate a knockdown of the gene of interest, HEK293 cells were transiently transfected with siGENOME SMARTpools (Dharmacon) directed against Non-Targeting Control #2 (D-001206-14), PARP10 (M-014997-03), PARP12 (M-13740-01), PARP14 (M-023583-02), and PARP15 (M-017186-00) using HiPerFect Transfection Reagent (QIAGEN) according to the manufacturer’s instructions for 72 h prior to transfection with in vitro transcribed replicon RNA (as described above). In short, immediately after seeding cells were transfected with a mixture of 55 µl of OptiMEM and 5 µl of HiPerFect Transfection reagent per ml of medium and a final siRNA concentration of 20 nM.

HEK293 Flp-In T-REx cells were transfected with pcDNA5/FRT/TO-N-TAP-nsP3, N-TAP-nsP3-macro, -PARP12 or the respective H564Y mutant and pOG44 (Invitrogen) using the calcium phosphate precipitation technique and selected by treating the cells with 15 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).

Sixteen h prior to transfection or infection HEK293 Flp-In T-REx cell lines were induced with 1 µg/ml doxycycline to induce the expression of stably integrated TAP-tagged constructs. Afterwards cells were transfected with in vitro transcribed replicon RNA as described above or infected with full-length virus as described below (see Virus infection and analysis of replication).

Twenty-four hpt with in vitro transcribed replicon RNA cells were treated with vehicle (DMSO), 25 µM MG132 (Sigma) or 200 nM Bafilomycin A1 (Baf.A1) (Enzo Life Sciences) for 6 h. Subsequently, supernatants were collected, and cells were lysed with RIPA buffer and subjected to SDS-PAGE and immunoblotting for analysis.

Reagents and antibodies

The following reagents were used: β-NAD+ (Sigma), 32P-NAD+ (Perkin-Elmer), IFNα (Peprotech), Olaparib (Selleck Chemicals), OUL35 (Tocris) [61], propidium iodide solution (Sigma), Protease inhibitor cocktail (Sigma), Glutathione-sepharose (Sigma), TALON metal affinity resin (BD Bioscience), GFP-Trap magnetic agarose beads (Chromotek, gtma), anti-GFP (Rockland, mouse monoclonal 600-301-215 M and goat polyclonal 600-101-215), anti-α-Tubulin (Sigma, T5168 and Santa Cruz, sc-23948), anti-MAR binding reagent (Millipore, MABE1076), anti-Poly/Mono-ADP Ribose (Cell Signaling, E6F6A), anti-nsP1 (obtained from Dr. Merits, see also [55]), anti-GST (clone 6G9), anti-PARP10 (clone 5H11 [17]), anti-PARP12 (Sigma, SAB2104087), anti-Actin (clone C4, BP Biomedicals), anti-HA (BioLegend, clone 16B12), goat-anti-rabbit-HRP (Jackson Immunoresearch, 111-035-144), goat-anti-mouse-HRP (Jackson Immunoresearch, 115-036-068), goat-anti-rat-HRP (Jackson Immunoresearch, 112-035-068), rabbit-anti-goat-HRP (Santa Cruz, sc-2768).

Rabbit polyclonal, purified CHIKV-nsP2-specific antibodies were generated by immunizing rabbits simultaneously with two peptides (aa570-584: CERKYPFTKGKWNINK, and aa740-755: CVLGRKFRSSRALKPP), both located in the C-terminal third of CHIKV nsP2 (performed by Eurogentec).

Cloning and mutagenesis

The SP6-CHIKV-replicon-SG-GLuc (hereafter referred to as replicon wt) construct was obtained from B. Kümmerer [53]. EGFP insertions were created on the basis of Utt et al. 2016 [55]. Linkers (5’-ACTAGTTCCGAGCTCGAG-3’) with restriction sites for SpeI and XhoI were introduced by PCR-based mutagenesis using the Q5 mutagensis kit (NEB) after codon 466 of nsP2 (2EGFP) or after codon 383 of nsP3 (3EGFP). The sequence encoding EGFP was amplified from pEGFP-C1 flanked by a SpeI restriction site and a Gly-Gly linker at the 5’-end and a Gly-Gly and a XhoI restriction site at the 3’-end by PCR and inserted into the linkers by restriction digestion and ligation. Single site mutations (C478A/S482A (CASA) in nsP2, D10A or V33E in nsP3 and D466A/D467A (GAA) in nsP4) were introduced into the replicon variants by insertion of custom-made DNA gBlocks (IDT). These were integrated by restriction digestion with NdeI for nsP2, BstAPI (5’-end) and ClaI (3’-end) for nsP3 or AgeI (5’-end) and AvrII (3’-end) for nsP4 and ligation.

GST-PARP10cat constructs were described previously [17]. pDest17-PARP10cat constructs were created from pDONRZeo-PARP10cat [17] using the Gateway cloning system (Thermo Fisher Scientific). The cDNAs encoding the catalytic domains PARP12 (G480-S688), PARP14 (K1600-K1800), PARP15 (N459-A656), and PARP16 (N459-A656) were generated from plasmids obtained from H. Schüler (Stockholm) and cloned into pDest17 using Gateway cloning. pGEX4T1-PARP12cat (489-684) was created from pNIC-28-BsaI-PARP12 (M1-Q701) plasmid that was obtained from O. Gileadi (Oxford) by Gateway cloning. pDest17-nsP3, pDest17-nsP3-macro and pGEX4T1-NEMO were described previously [6, 52]. pDest17-nsP2 and pDest17-nsP2-459-798 were generated with the Gateway cloning strategy using the SP6-CHIKV-replicon-SG-GLuc as a template.

The artificial protease substrate (pGEX4T1-nsP3/nsP4-site-polylinker-EGFP) was created based on the long nsP3/nsP4 site described in Rausalu et al. [59]. This sequence was ordered as oligos containing EcoRI (5’-end) and BamHI (3’-end) restriction sites mimicking overhangs (5’- aattcGACGAGTTAAGACTAGACAGGGCAGGTGGGTATATATTCTCGTCGgag-3’, 3’-gatcctcCGACGAGAATATATACCCACCTGCCCTGTCTAGTCTTAACTCGTCg-5’) that were annealed in vitro. The sequence encoding EGFP was isolated from pEGFP-N1 using BamHI and NotI restriction sites and EGFP as well as the annealed oligos were inserted into pGEX4T1 using EcoRI, BamHI and NotI restriction sites and ligation. Subsequently, a polylinker was introduced into this construct for better accessibility of the protease substrate. Therefore, oligos containing this polylinker, the nsP3/nsP4 site and EcoRI (5’-end) and NcoI (3’-end) restriction site mimicking overhangs (5’- aattcGACGAGTTAAGACTAGACAGGGCAGGTGGGTATATATTCTCGTCGGAGGATCCACCGGTCGCCACCGGCTCTGCCGCTGCCACAAGAGGCTCTGCTGGAAGCGGCGGATCTGCCACAGGCTCTGGATCTGCAGCTGGCTCTGGCGACTCTGTGGCTGCCGGATCTGGCGGAGGAAGCGGCTCTAc-3’, 3’- catggTAGAGCCGCTTCCTCCGCCAGATCCGGCAGCCACAGAGTCGCCAGAGCCAGCTGCAGATCCAGAGCCTGTGGCAGATCCGCCGCTTCCAGCAGAGCCTCTTGTGGCAGCGGCAGAGCCGGTGGCGACCGGTGGATCCTCCGACGAGAATATATACCCACCTGCCCTGTCTAGTCTTAACTCGTCg-5’) were annealed in vitro and inserted into the vector using EcoRI and NcoI restriction sites and ligation.

For the anti-GFP-nanobody constructs a human optimized sequence was ordered as a custom-made DNA gBlock (IDT) containing AgeI (5’-end) and XhoI(3’-end) restriction sites (5’-ACCGGTCGCCACCATGCAGGTGCAGTTGGTAGAGAGTGGGGGAGCACTTGTTCAACCTGGAGGAAGTCTGCGGCTGTCATGCGCCGCCTCAGGCTTCCCGGTGAACAGATATTCCATGCGCTGGTACCGGCAAGCACCTGGCAAGGAGAGAGAATGGGTTGCAGGAATGAGTTCCGCAGGAGACAGAAGCAGCTATGAGGATTCTGTGAAAGGAAGGTTCACTATTAGCCGGGACGATGCACGGAACACTGTGTATCTCCAGATGAATTCCCTGAAGCCGGAGGATACGGCTGTCTACTATTGTAATGTAAATGTTGGATTCGAGTACTGGGGTCAAGGAACGCAAGTGACAGTATCCAGCTCCGGACTCAGATCTCGAG-3’). This sequence was inserted into GW-pEGFP-nsP3-macro or GW-pEGFP-nsP3-macro-V33E using the AgeI and XhoI restriction sites and ligation, replacing the EGFP.

pEVRFO-HA and the pEGFP-PARP10 constructs were described previously [17, 66]. pHA-, pEGFP-C1- and pcDNA5/FRT/TO-C-TAP-PARP12 were created from the pNIC-28-BsaI-PARP12 (M1-Q701) plasmid that was obtained from O. Gileadi (Oxford) by Gateway cloning. Constructs for expression of eukaryotic fusion proteins of nsP2, nsP2-459-798, nsP3 and nsP3-macro were cloned into pcDNA3-Flag, pHA, pEGFP-C1 or pcDNA5/FRT/TO-N-TAP with Gateway cloning using the SP6-CHIKV-replicon-SG-GLuc as a template. Mutants (except for replicon mutants, see above) were generated using standard mutagenesis procedures (e.g. Q5 mutagenesis kit (NEB)) and confirmed by sequencing. pcDNA3-HA-PARP1 was a kind gift from M. Hottiger (Zürich) and pCMV-HA-PARP7 from Andreas Ladurner (München).

In vitro transcription of replicon RNA

For in vitro transcription of replicon RNA, DNA plasmids encoding the respective replicon variants were first linearized with NdeI. Subsequently, linearized DNA was transcribed using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cap-analog [m7G(5')ppp(5')G] and GTP were added to the reactions to obtain 5’-capped RNA. Afterwards template DNA was digested by addition of TURBO DNase and RNA was precipitated using the lithium chloride precipitation protocol. Finally, RNA was resuspended in elution buffer from the High Pure RNA isolation Kit (Roche). Purity was controlled by agarose gel electrophoresis, concentration was measured using a NanoDrop™ 1000 (Thermo Fisher Scientific) and RNA was stored at − 80 °C until transfection.

Purification of His6- and GST-tagged fusion proteins

His6- and GST-tagged fusion proteins were expressed in E. coli BL-21. The recombinant proteins were enriched and purified via affinity chromatography on either glutathione-sepharose for GST-fusion or TALON metal affinity resin for His6-fusion proteins according to standard protocols. Purification of His-nsP2-459-798, wt or inactive CASA mutant, took place without the addition of PIC to the lysis buffer.

Replicon assays

In vitro transcribed replicon RNA was transfected into cells as described above (see’In vitro transcription of replicon RNA and Cell lines and cell culture’). 100 µl of supernatants were collected 6, 9, 12, 24 and/or 30 hpt for analysis of Gaussia luciferase activity. Cells that were not transfected with replicon RNA functioned as negative control. Gaussia luciferase is under the control of the subgenomic promoter replacing the structural proteins and secreted into the supernatant [53]. Determining the Gaussia luciferase in the supernatant can thus function as a surrogate for CHIKV replication. To analyze the luciferase activity, the BioLux® Gaussia Luciferase Assay Kit (NEB, discontinued) or the GAR-2B Gaussia Luciferase Assay (Targeting Systems) were used according to the manufacturer’s instructions following the “Stabilized Assay Protocol I”. In short, 5 ml of dilution buffer were mixed with 800 µl of stabilizer and 50 µl of 100 × substrate and incubated protected from light for 25 min at room temperature. Afterwards 5 µl of supernatant per sample were pipetted into a 96-well plate (opaque, white) in duplicates and mixed with 50 µl of substrate solution and incubated for 35–40 s. Afterwards the counts per second (CPS) were measured with a VICTOR2 1420 multilabel counter (Perkin Elmer) measuring luminescence without a filter over 10 s. To determine relative replication, values were normalized to the mean value of the 2 technical replicates of the according sample and time per experiment.

Quantitative real-time PCR

To determine ISGs among the mono-ARTs, HeLa cells were stimulated with IFNα (180 U/mL). Total RNA was isolated using the High Pure RNA isolation Kit (Roche) according to the manufacturer’s protocol. Reverse transcription was performed with 1 µg of the isolated RNA using the QuantiTect Reverse Transcription Kit (Qiagen). mRNA expression levels of PARP3, PARP7, PARP10, PARP12, PARP14, PARP15 and PARP16 were analyzed by quantitative real-time PCR (qRT-PCR) using QuantiTect Primer Assays (QIAGEN). In all settings the mRNA expression of the gene of interest was normalized to GUS (forward 5’-CTCATTTGGAATTTTGCCGATT-3’ and reverse 5’-CCGAGTGAAGATCCCCTTTTTA-3’; IDT).

In vitro ADP-ribosylation assays

ADP-ribosylation assays were performed in 30 µl reaction buffer (50 mM Tris, pH 8.0, 2 mM TCEP, 4 mM MgCl2) with 50 µM β-NAD+ and 1 µCi 32P-NAD+. After 30 min incubation at 30 °C the reactions were stopped by addition of SDS sample buffer. Samples were fractionated by SDS-PAGE and gels subsequently stained with Coomassie blue to visualize the proteins. For the detection of the incorporated radioactive label, dried gels were exposed to X-ray films.

In vitro ADP-ribosylation assays with immunoprecipitated PARP10

HEK293 cells were seeded and after 48 h transfected with plasmids encoding HA-PARP10 or the inactive GW mutant using the calcium phosphate precipitation technique. 48 hpt cells were lysed in TAP lysis buffer (50 mM Tris, pH 7.5; 150 mM NaCl; 1 mM EDTA; 10% glycerol; 1% NP-40; 2 mM TCEP; PIC) and the lysates were centrifuged at 4 °C for 30 min. HA-PARP10 was immunoprecipitated with 1 μl of anti-HA (BioLegend) antibody and protein G beads at 4 °C for 1 h. Afterwards the beads were washed in TAP lysis buffer and reaction buffer (50 mM Tris, pH 8.0, 2 mM TCEP, 4 mM MgCl2). ADP-ribosylation assays were carried out as described above (chapter In vitro ADP-ribosylation assays).

In vitro protease assay

Bacterially expressed and purified His-nsP2-459-798, wt or inactive CASA mutant, were incubated with synthetic substrate in 15 µl of reaction buffer (50 mM Tris, pH 8.0, 2 mM TCEP, 4 mM MgCl2) for 30, 60 or 120 min at 30 °C. As a negative control substrate as well as proteases were incubated alone in reaction buffer for 0 or 120 min at 30 °C. The reactions were stopped by the addition of SDS sample buffer. Samples were fractionated by SDS-PAGE and gels subsequently stained with Coomassie blue to visualize the proteins.

ADP-ribosylation assay with subsequent in vitro protease assay

ADP-ribosylation assays were performed in 30 µl reaction buffer (50 mM Tris, pH 8.0, 2 mM TCEP, 4 mM MgCl2) with 50 µM β-NAD+ for 30 min at 30 °C. Where indicated 10 µM of OUL35 was added to stop the ADP-ribosylation reaction. Subsequently, synthetic substrate or His-nsP2-459-798 was added to the reactions and further incubated at 30 °C for 30, 60 or 120 min. As a negative control, substrate was incubated alone in reaction buffer for 0 or 120 min at 30 °C. The reactions were stopped by the addition of SDS sample buffer. Samples were fractionated by SDS-PAGE and gels subsequently stained with Coomassie blue or subjected to immunoblotting to visualize the proteins.

Immunoprecipitation for detection of MARylation in cells

HEK293 cells were seeded in 10 cm plates and 48 h after seeding transfected with plasmid DNA coding for GFP-nsP2 using the calcium phosphate precipitation technique or not treated. 24 h after DNA transfection or 72 h after seeding cells were transfected with in vitro transcribed replicon RNA as described above (chapter Cell lines and cell culture) but scaled up 10 × according to the amount of medium. 30 hpt cells were harvested in RIPA buffer (10 mM Tris, pH 7.4; 150 mM NaCl; 1% NP-40; 1% DOC; 0.1% SDS; PIC) and the lysates were centrifuged at 4 °C for 30 min. When immunoblotting was performed with the PAR/MAR-specific antibody, olaparib was added to the lysis buffer to prevent PARP1 activation upon cell lysis [67]. GFP-nsP2 or nsP2-2EGFP translated from the replicon RNA were immunoprecipitated with 5 µl GFP-Trap magnetic agarose beads (Chromotek) at 4 °C for 1 h. Afterwards beads were washed in RIPA buffer and reaction buffer (50 mM Tris, pH 8.0, 2 mM TCEP, 4 mM MgCl2). Subsequent hydrolase assays were carried out with bacterially expressed and purified His-nsP3-macro in 10 µl reaction buffer for 30 min at 30 °C. The reactions were stopped by the addition of SDS sample buffer. Samples were fractionated by SDS-PAGE and subjected to immunoblotting to visualize MARylation using the MAR reagent (Millipore) and the total proteins.

Flow cytometry analysis

Thirty hpt with in vitro transcribed RNA or a plasmid encoding EGFP, cells were washed once and resuspended in 500 µl PBS containing 2% heat-inactivated FCS. For the propidium iodide (PI) single stain control, cells were then fixed and permeabilized in 80% ethanol for 30 min at -20 °C and afterwards were washed twice and resuspended in 500 µl PBS containing 2% heat-inactivated FCS. All other samples were not fixed or permeabilized. Subsequently 50 µg/ml of PI solution (Sigma) were added to all samples and incubated in the dark for 20 min. A BD FACSCanto II (BD Bioscience) was used for the flow cytometry analysis of the samples. 100,000 events were counted per sample per experiment. Evaluation of the experiments was performed with the FlowJo software (BD Bioscience).

Virus infection and analysis of replication

Infectious CHIKV, strain LR2006-OPY, was produced by in vitro transcription of the linearized full-length viral genome including an EGFP under a second subgenomic promotor [54] and subsequent electroporation of the RNA in BHK-21 cells. The virus was passaged once in BHK-21 cells. Infections were performed under BSL-3 conditions using MOI determined by titration on HEK293T cells. Cells were fixed in 4% PFA and infection efficiency was measured as the proportion of EGFP-positive cells 24 and 48 h post infection by flow cytometry using a BD FACSLyric instrument (BD Bioscience). Evaluation of the experiments was performed with the FACSSuite v1.2.1.5657 software (BD Bioscience).

Quantification of immunoblots and statistical analysis

Immunoblots were quantified using the Image J software (NIH, Bethesda, USA). For the statistical analysis we calculated means of technical replicates for each independent biological experiment, ending up with “n” independent datapoints (n is indicated in the figure legends). Due to variations within individual experiments (e.g. due to the quality of the invitro transcribed large replicons, transfection efficiencies, etc.), we normalized our data to 1 in several of the experiments. Thereafter, the significance was analyzed by GraphPad Prism 9.5.0 software using a nonparametric, Kruskal–Wallis test, when more than two samples were analyzed in parallel. In cases, where we used raw data as the basis of graphs and statistics, we analyzed the data by Shapiro–Wilk test, which indicated that our data likely is normal distributed. Thereafter we used two-way ANOVA. The raw and the normalized data are summarized in Supplementary Table S1.