Ethics statement

Thirty IA patients from the Interventional Neuroradiology Department of Tongji Hospital at Tongji University (Shanghai, China) were recruited into this study between June 2019 and March 2021. Aneurysm sizes ranged from 2.5 × 1.5 mm to 20 × 15 mm. Age-matched healthy subjects without a family history of IA were included as controls (n = 30). No significant differences were found between the two groups in terms of aneurysm size and patient age (P > 0.05). Blood samples were collected from all subjects. Samples were centrifuged at 2800×g for 5 min after standing for 0.5 h at room temperature (RT). Serum samples were divided into aliquots, which we maintained at − 80 °C. IA tissues were removed during clipping surgery, and snap-frozen in liquid N2. Normal superficial temporal arteries were collected from trauma patients receiving craniotomy treatments.

Overexpression and interference vector constructs

Human siRNA against circ-ATL1 (si-circ-ATL1), the miR-455 inhibitor (miR-455 inhibitor: 5′–GUGUAUAUGCCCAUGGACUGC–3′) and negative control inhibitor (inhibitor-NC: ACGUGACACGUUCGGAGAATT) were obtained from GenePharma (Shanghai, China). For SIRT5 overexpression, we constructed a SIRT5 eukaryotic expression vector (SIRT5/pcDNA3.1) by placing the SIRT5 open reading frame into pcDNA3.1(+). For luciferase reporters, SIRT5 3′-UTR and circ-ATL1 were amplified from human genomic DNA. We mutated miR-455 binding sites within SIRT5 3′-UTR and circ-ATL1 to eliminate complementarity. Mutant (MUT) or wild-type (WT) SIRT5 3′-UTR and circ-ATL1 were cloned into psiCHECK-2 luciferase vectors for the luciferase reporter assays. The plasmids were confirmed through sequencing.

Cell culture and transfection

Human VSMCs (ATCC, Manassas, VA, USA) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS), glutamine and penicillin/streptomycin at 37 °C in an humidified atmosphere of 5% CO2. VSMCs were transfected with miR-455 inhibitor or si-circ-ATL1 at a concentration of 50 nM using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. For SIRT5 overexpression, VSMCs were transfected with 1 μg SIRT5 plasmid or control vector. Transfected cells were used in subsequent experiments 2 days after transfection.

Subcellular fractionation

Nuclear-cytoplasmic RNA fractionation was performed using a Nuclear and Cytoplasmic Extraction Reagents Kit (Thermo Fisher Scientific) following the manufacturer’s protocol. We extracted and captured circ-ATL1 and linear ATL1 in nuclear and cytoplasmic VSMC fractions. U6 or GAPDH were used as internal controls.

Bioinformatic analyses

Circular RNA Interactome was used to identify circRNA and miRNA target genes. TargetScan was utilized to predict interactions between miRNAs.

Fluorescence in situ hybridization (FISH)

Geneseed Biotech (Guangzhou, China) constructed specific probes to circ-ATL1 (Dig-5′-GGAAAATTGAAAGAGTCTGATATTTCTTG-3′-Dig). Signals were captured through FITC-conjugated anti-digoxin anti-biotin antibodies (Jackson ImmunoResearch Inc., West Grove, PA, USA). Nuclei were counterstained using 4,6-diamidino-2-phenylindole (DAPI). Figures were plotted using a Zeiss LSM 700 confocal microscope (Carl Zeiss, Oberkochen, Germany).

Western blot analysis

Protein was extracted from cells or tissues using lysis buffer containing protease inhibitors. Samples were centrifuged at 12,000×g at 4 °C. Protein concentrations were determined using a BCA Kit (Pierce, Rockford, IL, USA). Protein samples (40 μg) were separated by SDS-PAGE, then transferred to polyvinylidene difluoride membranes. After blocking in 5% fat-free milk, membranes were incubated overnight at 4 °C with the following primary antibodies: anti-MMP-3, anti-SM-MHC, anti-SM-α-actin, anti-MMP-2, anti-SM22 and anti-GAPDH. The antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA), and used at dilution of 1:1000. Membranes were incubated for 1 h at RT with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology). Samples were visualized using an Enhanced Chemiluminescence Detection Kit (Amersham Biosciences, Piscataway, NJ, USA). Protein bands were normalized against loading controls, and quantified using the Quantity One program (Bio-Rad, Hercules, CA, USA).

Cell proliferation assay

To examine the effects of circ-ATL1, miR-455, and SIRT5 on VSMC proliferation, we transfected VSMCs with circ-ATL1, miR-455, and SIRT5 separately or in combination. Cells were seeded onto six 96-well plates at a density of 2 × 103 cells/well. Proliferation levels were detected using a CCK8 kit (Dojindo Laboratories, Kumamoto, Japan) and enzyme-linked immunosorbent assay reader (Thermo Labsystems, MA, USA) following the manufacturer’s instructions. Data were collected from > = 3 independent experiments that had been carried out in triplicate.

Cell migration assay

Cells that had been transfected in 200 μL serum-free DMEM medium were resuspended and seeded onto Boyden chambers (Corning, Corning, NY, USA) containing a 8.0-μm pore membrane (5 × 104 cells/well) for migration assays. Cells were incubated in DMEM containing 20% FBS at 37 °C in an atmosphere of 5% CO2. After 1 day, cells adhering to the lower chamber surface were fixed, while cells on the upper surface were removed. After staining with 0.05% Crystal Violet solution, cells were counted in three randomly selected high-power fields by light microscopy (Olympus, Tokyo, Japan). Migration assays were carried out in triplicate.

RNA extraction and RT-PCR assays

Total RNA was extracted from IA serum or VSMCs using TRIzol reagent (Invitrogen). Reverse transcription was carried out using the Superscript First Strand cDNA Synthesis System (Invitrogen). We performed RT-PCR using the One Step SYBR® Prime Script TM RT-PCR Kit II (Takara, Tokyo, Japan). GAPDH and U6 were used as the internal controls in mRNA and miRNA assays. Results were analyzed using the 2−ΔΔCt method. The following primers were used: GAPDH (forward primer: 5′-AAGCTCACTGGCATGGCCTT-3′; reverse primer: 5′-CGGCATGTCAGATCCACAAC-3′); U6 (forward primer: 5′-CTCGCTTCGGCAGCACA-3′; reverse primer: 5′-AACGCTTCACGAATTTGCGT-3′); circ-ATL1 (forward primer: 5′-GATGGAAAATTGAAAG-3′; reverse primer: 5′-CCAGTCTCGAACAAG-3′); miR-455 (forward primer: 5′-ACACTCCAGCTGGGGCAGTCCACGGGCATATACAC-3′; reverse primer: 5′-GTGCAGGGTCCGAGGT-3′); SIRT5 (forward primer: 5′-GTCATCACCCAGAACATCGA-3′; reverse primer: 5′-ACGTGAGGTCGCAGCAGCAAGCC-3′).

Luciferase assay

miRNA target validation assays were carried out as described previously [15]. Briefly, we seeded VSMCs into 12-well plates at a density of 120,000 cells/well, 1 day before transfection. Cells were co-transfected with 100 ng empty psiCHECK-2 vector or psiCHECK-2 + miR-455, or control vector constructs using Lipofectamine 2000 following the manufacturer’s protocol. We constitutively utilized expressed the firefly luciferase gene in the psiCHECK-2 vector as the normalization control. Three days after transfection, Renilla and firefly luciferase activities were measured concomitantly with a luminometer (Promega, Madison, WI, USA).

Statistical analyses

Results are expressed as mean ± standard mean error (SME). We employed the two-tailed Student’s t-test to compare differences among groups with GraphPad Prism (GraphPad Software, La Jolla, CA, USA). P < 0.05 was considered to be statistically significant.