Cell lines and cell culture

PCa cells LNCaP and VCaP and normal prostate epithelial cells RWPE-1 were purchased from the American Type Culture Collection (ATCC). C4-2 and CWR22Rv1 cells were the gifts from Dr. Chinghai Kao in Department of Urology, Indiana University School of Medicine. HEK293T cells were obtained from Center for Molecular Medicine of Xiangya Hospital, Central South University. LNCaP, VCaP, C4-2, and CWR22Rv1 were cultured in RPMI-1640 medium supplied with 10% fetal bovine serum (ExCellBio, Shanghai, China). HEK293T were cultured in DMEM supplied with 10% fetal bovine serum. RWPE-1 was cultured in defined Keratinocyte-SFM (1×) liquid (Invitrogen, Carlsbad, CA, USA). All cells were incubated at 37 °C with 5% CO2.

Generation of LNCaP-R and CWR22RV1-R cell lines

LNCaP or CWR22Rv1 cells were initially cultured in the media containing 20 uM abiraterone, and the living cells were cultured with the gradually increased drug concentrations for continuous 6 months. The IC50 values of cells response to abiraterone were identified by crystal violet assays. The LNCaP or CWR22Rv1 cells, whose IC50 values of abiraterone are over 50 uM were regarded as the abiraterone-resistant LNCaP-R and CWR22Rv1-R cells.

Antibodies and reagents

Anti-UHRF1 (A2343), Anti-β-Tubulin (A12289), Anti-NCAM1 (A7913), Anti-Synaptophysin (A6344), Anti-USP7 (A13564), Anti-BTRC (A18232) were purchased from ABclonal (Wuhan,HuBei, China). Anti-Cleaved-PARP, Anti-AKT (phospho S473) were purchased from Abcam (Cambirdge,MA,USA). Anti- Akt (pan) (#4685), Anti-HA Tag (#3724), Anti-p21(#2947), Anti-Phospho-AKT (Thr308) (#13038), Anti-Normal Rabbit IgG (#2729) were purchased from Cell Signaling Technology(Danvers, MA, USA), Anti-AKT1 antibody [HL1145] (#GTX636416) was purchased from GenTex (Irvine, CA, USA), Anti-His Tag(A00186) was purchased from GenScript (Nanjing, Jiangsu, China), p-Thr(H-2) was purchased from Santa Cruze Biotechnology(Shanghai, China). Monoclonal ANTI-Flag® M2 antibody (F1804) and Normal Mouse IgG (12-371) were purchased from Merck (Darmstadt, Germany).

Cycloheximide (HY-12320), MK2206 (HY-108232), and Protein A/G Magnetic Beads (HY-K0202) were purchased from MedChemExpress LLC. (Shanghai, China). MG132 (T2154) was purchased from Topscience Co. Ltd. (Shanghai, China). Lipo6000™ Transfection Reagent(C0526), a cationic liposome for transfection of HEK293T cells, was purchased from Beyotime (Shanghai, China).

Plasmids and primers

The wild-type UHRF1 and UHRF1-T210A mutant were cloned into pcDNA3.1/His or pGEX4T-1 vectors, and pcDNA3.1-Flag-myr-AKT1 was purchased from MiaoLing Plasmid Sharing Platform (Wuhan, Hubei, China). The sequences of primers for PCR in this study are as follows. UHRF1(Forward: 5’GACAAGCAGCTCATGTGCGATG3’; and reverse: 5’ AGTACCACCTCGCTGGCATCAT3’) and ACTIN(Forward: 5’ CACCATTGGCAATGAGCGGTTC3’, and reverse: 5’ AGGTCTTTGCGGATGTCCACGT3’).

RNA extraction and qRT-PCR

Total RNA was exacted by using RNAiso PLUS following the manufacturer’s instructions. Total RNA (1 ug) was used for synthesizing the first strand cDNA by using Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific™). 2×SYBR Green qPCR Master Mix (Bimake, Houston, TX) were used for the qPCR. The relative mRNA expression levels were normalized to ACTIN. The statistical difference of the results was analyzed by Student’s t-test, and the significance of data was determined by p-value <0.05.

Western blotting

Cells were washed with cold PBS three times and lysed with cell lysis buffer (Beyotime) for western blotting and IP assays. Cell lysates were separated by SDS-PAGE and then transferred to PVDF membranes (Millipore, Burlington, MA. USA), followed by blocking in 5% milk for 1 h at room temperature. The membranes were washed with TBS containing 1% Tween 20 for three times, and incubated with primary antibodies overnight at 4 °C. After incubating with the second antibodies, the membranes were exposed to chemiluminescence substrate, and the signals were detected by using Chemiluminescence Image Analysis System (Clontech, Mountain View, USA).

Co-immunoprecipitation assay

1 × 106 HEK293T cells were co-transfected with pcDNA3.1/His-UHRF1 and pcDNA3.1-Flag-myr-AKT1. The transfected cells were washed with cold PBS for three times and lysed in cell lysis buffer 48 h after transfection. The cell extracts were incubated with 1 ug Anti-His Tag (A00186, GenScript, Nanjing, Jiangsu, China) or 1 ug Anti-Flag Tag (F1804) at 4 °C overnight, followed by incubating with 20 ul Protein A/G Magnetic Beads at 4 °C for one hour. The beads coupled with immunoprecipitates were washed five times with cell lysis buffer, and then harvested for western blotting.

Ubiquitination detection assay

HEK293T cells were co-transfected with pcDNA3.1/His-UHRF1, pcDNA3.1- Flag-myr-AKT1, and pcDNA3.1-HA-Ub for 48 h, and then were treated with 50 uM MG132 plus DMSO or 10 uM MK2206 for 8 h, respectively. Then cells were lysed in RIPA cell lysis buffer and the extraction were incubated with 1 ug Anti-His Tag(A00186, GenScript) at 4 °C overnight on a rotating shaker. Protein A/G Magnetic Beads (20 ul) were added and incubated for 1 h. The immunoprecipitates were used for western blotting analysis.

Recombinant protein purification

The plasmids expressing GST-UHRF1-WT and GST-UHRF1-T210A were constructed in pGEX4T-1 vector, and the recombinant proteins were generated and purified following the manufacturers’ manuals (Sangon, Shanghai, china). Briefly, the plasmids pGEX4T-1-UHRF1-WT or pGEX4T-1-UHRF1-T210A were separately transformed to Bacterial BL21 cells for 12 h, and 50 mg/ml IPTG was added to induce the expression of GST-UHRF1-WT and GST-UHRF1-T210A at 20 °C for 16 h. Next, the BL21 cells were collected, and GST tagged UHRF1-WT and UHRF1-T210A proteins were purified by using GST-Sefinose (TM) Resin 4FF (Sangon). The purity of GST-UHRF1-WT or GST-UHRF1-T210A was detected by Coomassie staining after SDS-PAGE.

In vitro kinase assay

pcDNA3.1-Flag-myr-AKT1 was transfected to HEK-293T cells, and the myr-AKT1 proteins firstly were immunoprecipitated with the anti-Flag antibody. The myr-AKT1 immunoprecipitates were resuspended in 500 μl 1× kinase buffer (#9802, Cell Signaling Technology) including 500 μM ATP (#9804, Cell Signaling Technology), and then co-cultured with 1ug recombinant proteins GST-UHRF1-WT or GST-UHRF1-T210A or negative control at 30 °C for 30 min, and then the reaction was stopped by adding SDS sample buffer at 95 °C for 5 min. The sample were used to western blotting.

Cell viability assay

RWPE-1, LNCaP, C4-2, CWR22Rv1, VCaP, LNCaP-R, and CWR22Rv1-R were seeded in 24-well cell culture plates, and treated with the indicated concentrations of abiraterone and MK2206 alone or in combination for 7 days. The cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet solution for 15 min. After removing the unbound crystalline violet, the plates were washed with ddH2O and dried at 37 ℃ for 1 h. The cells were lysed on a shake table overnight by 1% SDS. Cellular viability was assessed by measuring the absorbance at 590 nm with VICTOR Nivo microplate reader.

Cell apoptosis assay

Apoptotic cells were quantified by using the Annexin V/FITC Apoptosis Detection Kit (BD Biosience, Shanghai, China) by following the manufacturer’s instruction. PCa cells were treated with the indicated concentrations of abiraterone or MK2206 alone or in combination for 2 days, then the cells were harvested by using EDTA free trypsin and centrifuged at 1000 rpm for 3 min. Afterward, Cells were washed with PBS three times and incubated with 100 ul of the 1× binding buffer including 5 ul PI and 5 ul Annexin-V for 15 min. The positive Annexin-V/PI staining cells were detected by BD FACSAria II flow cytometer.

In vivo study

The animal experiments were approved by the Institutional Animal Care and Use Committees(IACUCs) of The First Affiliated Hospital, Guangdong Pharmaceutical University according to the corresponding guidelines. Firstly, the xenograft models were induced by subcutaneously injecting 5 × 106 CWR22Rv1 cells into the left axillary of 4–5-week-old male BALB/c-nude mice (n = 20). After the volume of the xenografts reached 100 mm3, the animals were randomly divided into four groups, and then treated with vehicle (control), abiraterone (100 mg/kg.d, i.g., every 3 days), MK2206 (70 mg/kg.d, i.g., every 3 days), or abiraterone (100 mg/kg.d, i.g., every 3 days) plus MK2206 (70 mg/kg.d, i.g., every 3 days) for 15 days. The tumor volume was calculated by the following equation: (L × W2)/2 (length (L) and width (W)).The body weight and tumor volume of mice were measured every 3 days, and the tumor growth curve and mouse body weight growth curve were plotted. At the endpoint of experiments, the tumors were dissected, and the weights of tumor nodes and animal bodies were recorded.

Statistical analysis

All statistical analyses were performed by using SPSS 23.0 software. Student’s two-tailed t-test was used to analyze the statistical difference between two sets of data. One-way ANOVA was used for statistical analysis of difference of multiple groups. Results were represented as mean ± SD. All tests were two-tailed, P-values <0.05 were considered statistically significant (*P < 0.05, **P < 0.01, and ***P < 0.001).