記住我
Conceptualization, Y.S.; Data curation, W.Z. and H.L.; Formal analysis, W.Z. and M.X.; Funding acquisition, Y.S. and W.Z.; Resources, H.L., F.Z., Z.C., G.A., S.H., Y.H., X.W., J.L., X.Z., Y.Z. and S.R.; Validation, W.Z.; Visualization, S.H.; Writing—original draft, Y.S., W.Z. and M.X.; Writing—review and editing, Y.S., G.A. and S.R. All authors have read and agreed to the published version of the manuscript.
Figure 1. Characteristics of the glutamate receptor-like (GLR) genes in rice. (a) Chromosome location of the OsGLR genes; (b) phylogenetic tree of GLR genes in rice, tomato and Arabidopsis thaliana; (c) intron–exon distribution of the OsGLR genes; (d) conserved motif prediction of the OsGLR genes. The conserved motif can provide insights into how patterns of residue conservation and divergence in a protein family relate to functional properties, and can provide useful links to more detailed information that may be helpful in understanding that those sequences have all four subfamily/structure/function relationships. There are four subfamilies, two large subfamilies and two small subfamilies. Arabidopsis thaliana has only three subfamilies (groups 1, 2 and 4).
Figure 1. Characteristics of the glutamate receptor-like (GLR) genes in rice. (a) Chromosome location of the OsGLR genes; (b) phylogenetic tree of GLR genes in rice, tomato and Arabidopsis thaliana; (c) intron–exon distribution of the OsGLR genes; (d) conserved motif prediction of the OsGLR genes. The conserved motif can provide insights into how patterns of residue conservation and divergence in a protein family relate to functional properties, and can provide useful links to more detailed information that may be helpful in understanding that those sequences have all four subfamily/structure/function relationships. There are four subfamilies, two large subfamilies and two small subfamilies. Arabidopsis thaliana has only three subfamilies (groups 1, 2 and 4).
Figure 2. Prediction of transmembrane helices of the 26 glutamate receptor-like (GLR) genes in rice. The plot shows the posterior probabilities of inside/outside/TM helix. The plot is obtained by calculating the total probability that a residue sits in helix, inside or outside summed over all possible paths through the model.
Figure 2. Prediction of transmembrane helices of the 26 glutamate receptor-like (GLR) genes in rice. The plot shows the posterior probabilities of inside/outside/TM helix. The plot is obtained by calculating the total probability that a residue sits in helix, inside or outside summed over all possible paths through the model.
Figure 3. Three-dimensional (3D) structure prediction of the glutamate receptor-like (GLR) genes in rice. Green helices represent α-helices, blue arrows indicate β-strands and faint lines indicate coil. Confidence is colored from high (red) to low (blue) using a rainbow spectrum.
Figure 3. Three-dimensional (3D) structure prediction of the glutamate receptor-like (GLR) genes in rice. Green helices represent α-helices, blue arrows indicate β-strands and faint lines indicate coil. Confidence is colored from high (red) to low (blue) using a rainbow spectrum.
Figure 4. Cis-acting regulatory elements of the 26 glutamate receptor-like (GLR) genes in rice. Different colors indicate different cis-acting elements. ABRE: ABA-Responsive Element; ACE: Angiotensin-Converting Enzymes; LTR: Low-Temperature Responsiveness; MBS: Multichain Binding Site; MRE: MYB-Recognizing Elements; MSA-like: Mitosis-Specific Activator; SP1: Stress-related Protein.
Figure 4. Cis-acting regulatory elements of the 26 glutamate receptor-like (GLR) genes in rice. Different colors indicate different cis-acting elements. ABRE: ABA-Responsive Element; ACE: Angiotensin-Converting Enzymes; LTR: Low-Temperature Responsiveness; MBS: Multichain Binding Site; MRE: MYB-Recognizing Elements; MSA-like: Mitosis-Specific Activator; SP1: Stress-related Protein.
Figure 5. The functional interaction network of the 26 glutamate receptor-like (GLR) genes in rice. The network view summarizes the network of predicted associations for a particular group of proteins. The network nodes are proteins. The edges represent the predicted functional associations. The thickness of the lines indicates the degree of confidence prediction of the interaction. The middle red protein represents the rice glutamate receptor-like gene or the homolog of rice glutamate receptor gene. Red line—indicates the presence of fusion evidence; green line—neighborhood evidence; blue line—co-occurrence evidence; purple line—experimental evidence; yellow line—text-mining evidence; light blue line—database evidence; black line—co-expression evidence.
Figure 5. The functional interaction network of the 26 glutamate receptor-like (GLR) genes in rice. The network view summarizes the network of predicted associations for a particular group of proteins. The network nodes are proteins. The edges represent the predicted functional associations. The thickness of the lines indicates the degree of confidence prediction of the interaction. The middle red protein represents the rice glutamate receptor-like gene or the homolog of rice glutamate receptor gene. Red line—indicates the presence of fusion evidence; green line—neighborhood evidence; blue line—co-occurrence evidence; purple line—experimental evidence; yellow line—text-mining evidence; light blue line—database evidence; black line—co-expression evidence.
Figure 6. Chromatin accessibility of the glutamate receptor-like (GLR) genes in rice. Six tissues (root (RT), young leaf (YL), flag leaf (FL), young panicle (YP), lemma and palea (LP), and stamen and pistil (SP)) of Zhenshan 97 (an indica/xian variety) were collected for ATAC-seq experiment.
Figure 6. Chromatin accessibility of the glutamate receptor-like (GLR) genes in rice. Six tissues (root (RT), young leaf (YL), flag leaf (FL), young panicle (YP), lemma and palea (LP), and stamen and pistil (SP)) of Zhenshan 97 (an indica/xian variety) were collected for ATAC-seq experiment.
Figure 7. Gene presence (a) and distribution frequency (b) of the glutamate receptor-like (GLR) genes in 3010 rice accessions. The first heatmap indicates the distribution in subspecies of this gene. The second heatmap indicates the presence frequency in subgroups of this gene. A total of 3010 rice accessions were divided into five subspecies, including JAP (japonica, 801 accessions), IND (indica, 1764 accessions), AUS (aus/boro, 221 accessions), ARO (aromatic basmati/sadri, 101 accessions) and ADM (admixed, 123 accessions). All of these were further grouped into 12 groups according to the classification of their corresponding rice accessions. These groups include four subgroups (IG1, IG2, IG3, IG4, IG5) of Indica subspecies AUSG6, four subgroups (JG7, JG8, JG9, JG10) of Japonica subspecies AROG11, and admixtures (ADM).
Figure 7. Gene presence (a) and distribution frequency (b) of the glutamate receptor-like (GLR) genes in 3010 rice accessions. The first heatmap indicates the distribution in subspecies of this gene. The second heatmap indicates the presence frequency in subgroups of this gene. A total of 3010 rice accessions were divided into five subspecies, including JAP (japonica, 801 accessions), IND (indica, 1764 accessions), AUS (aus/boro, 221 accessions), ARO (aromatic basmati/sadri, 101 accessions) and ADM (admixed, 123 accessions). All of these were further grouped into 12 groups according to the classification of their corresponding rice accessions. These groups include four subgroups (IG1, IG2, IG3, IG4, IG5) of Indica subspecies AUSG6, four subgroups (JG7, JG8, JG9, JG10) of Japonica subspecies AROG11, and admixtures (ADM).
Figure 8. The gene-coding sequence haplotype (gcHap) diversity of the glutamate receptor-like (GLR) genes in modern and 3010 rice accessions. The 3010 rice accessions were divided into five subspecies, including Xian (indica, 1764 accessions), Geng (japonica, 801 accessions), Aus (aus/boro, 221 accessions), Aro (aromatic basmati/sadri, 101 accessions) and Adm (admixed, 123 accessions).
Figure 8. The gene-coding sequence haplotype (gcHap) diversity of the glutamate receptor-like (GLR) genes in modern and 3010 rice accessions. The 3010 rice accessions were divided into five subspecies, including Xian (indica, 1764 accessions), Geng (japonica, 801 accessions), Aus (aus/boro, 221 accessions), Aro (aromatic basmati/sadri, 101 accessions) and Adm (admixed, 123 accessions).
Figure 9. Tissue expression patterns of the glutamate receptor-like (GLR) genes in rice. Gene expression data generated by the Affymetrix ATH1 array are normalized by MAS 5.0 and RMA methods with a trimmed mean target intensity (TGT) value.
Figure 9. Tissue expression patterns of the glutamate receptor-like (GLR) genes in rice. Gene expression data generated by the Affymetrix ATH1 array are normalized by MAS 5.0 and RMA methods with a trimmed mean target intensity (TGT) value.
Figure 10. Expression analysis of the glutamate receptor-like (GLR) genes in rice. The shoot (a) and root (b) expression variation of OsGLR genes under a variety of hormone treatment conditions. Blue is low expression, red is high expression. Expression variation of OsGLR genes under drought (c), flood (d) and cold (e) stress conditions. Green is low expression, red is high expression.
Figure 10. Expression analysis of the glutamate receptor-like (GLR) genes in rice. The shoot (a) and root (b) expression variation of OsGLR genes under a variety of hormone treatment conditions. Blue is low expression, red is high expression. Expression variation of OsGLR genes under drought (c), flood (d) and cold (e) stress conditions. Green is low expression, red is high expression.
Table 1. Semi-quantitative primers of the glutamate receptor-like (GLR) genes in rice.
Table 1. Semi-quantitative primers of the glutamate receptor-like (GLR) genes in rice.
Gene idGene NameThe Upstream Primer (5’-3’)Downstream Primers (5’-3’)Os09t0431100OsGLR9.7GATGGTTGCTGATGGGGCATTCCTTCAGGAACACCCACGTCCOs09t0429000OsGLR9.3ATAACAGCTTCTGGGTATGCGATATGGCTGCATCATATACCCCTAGOs06t0680500OsGLR6.12CTAAACACAATCGACGAGTACGCAATCTCTCTGGAATGCGAATCCCOs04t0585200OsGLR4.1ACCGTCAATTTGTATCAGTTGATAGATAAGCTCCGAATAGCTTGGATTCOs06t0188700OsGLR6.4TCGTGGTGGACATGACGAGCCTTGATAAGGTCTTCGGCGGCOs07t0103100OsGLR7.1ATCATCCAAGGTCTGCAGGTGATAGGAAGTAAGGGTATTGGGAGGAOs02t0787600OsGLR2.2TGTTCGACGAGGTCATGAAGATTCATCTGCCTTCTGTGACGACAOs09t0428300OsGLR9.1AGAAAGGCAGAGGAATTCCATGTCCAGCAAATCAAGAACTGCAGATOs03t0234200OsUBQ AAGAAGCTGAAGCATCCAGCCCAGGACAAGATGATCTGCCTable 2. Genome-wide identification and characteristics of the glutamate receptor-like (GLR) genes in rice.
Table 2. Genome-wide identification and characteristics of the glutamate receptor-like (GLR) genes in rice.
SubfamilyRAP IDGene NameNo. of Amino AcidsMolecularTable 3. KAKS analysis of the glutamate receptor-like (GLR) genes in rice.
Table 3. KAKS analysis of the glutamate receptor-like (GLR) genes in rice.
Seq_1Seq_2KaKsKa_KsMyaOsGLR6.8OsGLR6.90.170.320.5324.53OsGLR9.5OsGLR9.30.060.270.2220.93OsGLR9.5OsGLR9.60.070.280.2521.61OsGLR9.6OsGLR9.30.060.270.2221.07
留言 (0)