Study subjects

Keloid tissues and surrounding normal skin tissues were collected from 5 patients with keloid. The keloids were removed according to previous description [36]. This study was reviewed and approved by the ethics committee of Yanbian Hospital (Approval No: ybyy-2020–03,010). All methods were performed in accordance with the relevant guidelines and regulations. Patients or their legal guardians were informed and consented to the study before sample collection and signed the informed consent.

Cell culture

Human keloid fibroblasts (HKF) were purchased from Hunan Fenghui Biotechnology Co., Ltd. (Changsha, China). Human fibroblasts were from Yanbian Hospital. They were cultured in DMEM/F12 culture medium containing 10% FBS and 100 U/ml penicillin and 100 μg/ml streptomycin at 37° C with 5% CO2.

HE staining

Keloid tissues and surrounding normal skin tissues were fixed in 10% formaldehyde for more than 72 h, washed overnight with running water, embedded in paraffin after gradient dehydration, and cut into 4 μm sections. The sections were subjected to hematoxylin staining for 5 min and eosin staining for 1 min. The pathological changes were observed under microscope.

Cell transfection

Cells in logarithmic growth phase were transfected with siNC, siRUNX3, siNC and siEZH2 for 24 h by using Lipofectamine 3000. At 24 h after transfection, SiEZH2 + EX527 groups were treated with EX527 (10 μM; MedChemExpress) for 24 h.

RT-PCR

Cellular RNA was extracted with RNA simple Total RNA Kit (DP419; TIANGEN BIOTECH CO., Ltd, Beijing, China). Reverse transcription was performed. The primer sequences were: EZH2, forward: 5 ‘-GCCAGACTGGGAAGAAATCTG-3’, reverse: 5 ‘-TGTTGGAAAATCCAAGTCA-3’; RUNX3, forward: Reverse TTTCACCCTGACCATCACTGTG, reverse: GCATCCCACTGGTGAAGGTTG; and, GAPDH, forward: 5 ‘-GGTGAAGGTCGGAGTCAACGGA-3’, forward: 5 ‘-GAGGGATCTCGCTCCTGGAAGA-3’. The FastKing One Step RT-PCR Kit (TIANGEN BIOTECH CO., Ltd, Beijing, China) was used. The RT-PCR system (total volume 25 µl) included 2 × FastKing One Step RT-PCR Master Mix 12.5 μl, 25 × RT-PCR Enzyme Mix1 µl, forward primer (10 µM) 0.6 µl, reverse primer (10 µM) 0.6 µl, RNA template 1 µl, and RNase-FreeddH2O 9.3 µl. The RT-PCR procedure included 42° C for 30 min, 95° C for 3 min; 35 cycles of 94° C for 30 s, 55° C for 20 s, and 72℃ for 30 s; and 72° C for 5 min. The PCR products were analyzed by agarose gel electrophoresis.

Immunoprecipitation

Proteins were extracted from HKF with protein extraction kit. Freshly extracted protein sample (200 μl) was incubated with 2 μl of acetyl-lysine antibody at 4° C overnight. Then, 40 μl of fully resuspended ProteinA + G Agrarose beads (Beyotime Biotechnology) was added and incubated at 4° C for 3 h, followed by centrifugation at 3000 r/min for 5 min at 4° C. The pellet was collected, washed five times with precooled PBS, and subjected to Western blot analysis of acetylated EZH2.

Protein stability testing

To determine the half-life of EZH2 protein, HKF cells were treated with 0.1 μg/mL cyclohexylamine (CHX) (Sigma-Aldrich) for 0 h, 3 h, 6 h, 9 h and 12 h, and EZH2 protein levels were measured by Western blot. Based on the observations in this experiment, three time points were selected to test cells after EX527 treatment with 0.1 μg/mL CHX. The treated cells were then washed three times with cold PBS to remove CHX, followed by extraction of whole cell lysate and Western blot.

Scratch test

Keloid fibroblasts were cultured in 12-well plates, and the transfection efficiency was observed by Cytation5 after 24 h of RUNX3 transfection. Scratches were made on the plate with a tip. After washing three times with PBS, the cell culture was continued with serum-free culture medium. The cells were photographed at 0, 12, and 24 h after scratch.

CFSE proliferation assay

Cells were seeded in a 6-well plate (5 × 104cells/well), washed with 1 × PBS, and incubated in CFSE working solution (1 μM) at 37° C for 20 min in the dark. The serum-free culture medium was replaced with complete culture medium to continue the culture. After culture for 12 h and 24 h, the cells were collected and detected on the flow cytometer at 530 nm.

Cell cycle assay

Cells were collected, washed with PBS and incubated with precooled 70% ethanol for 4 h at 4 °C. After washing, PI and RNaseA were added, respectively, and incubated for more than 30 min at 4 °C in the dark. Cell cycle was detected on the flow cytometer (Beckman Coulter Biotechnology (Suzhou) Co, Ltd).

Western blot

Keloid tissues and its surrounding normal skin tissues were homogenized, lysed in RIPA for 30 min, and centrifuged at 12,000 r/min for 5 min. The supernatant was collected and the protein concentration was determined with BCA method. Similarly, proteins were also extracted from cells. After SDS-PAGE electrophoresis, the proteins were transferred to PVDF membranes. The membrane was blocked with 5% skimmed milk for more than 2 h, and washed with TBST for 5 min/time for 3 times. Then, the diluted primary antibodies against RUNX3 (1:2000; Abcam, USA), EZH2 (1:2000; Abcam, USA), AC-EZH2 (1:2000; Abcam, USA), SIRT1 (1:2000; Abcam, USA), CyclinD1 (1:2000; Abcam, USA), CDK2 (1:2000; Abcam, USA), CDK4 (1:2000; Abcam, USA), and β-actin (1:2000; Abcam, USA) were added and incubated overnight at 4° C. After incubation with goat anti-rabbit/goat anti-mouse secondary antibody (1:5000; Abcam, USA) for 70 min at room temperature, the membrane was subjected to ECL luminescence color development.

Flow cytometry

The skin tissues were homogenized and filtered to prepare a single cell suspension. After washing and centrifugation, the cells were fixed with 4% paraformaldehyde for 10 min. After washing again, the cells were incubated with 10% methanol for 10 min, and then with 5% BSA for 1 h. After that, the antibodies against Vimentin (1:250; Abcam, USA) and RUNX3 (1:500; Abcam, USA) were added and incubated for 1 h. Following washing, the secondary antibody (1:2000; Abcam, USA) was added for 1 h incubation. Finally, the cells were detected on the flow cytometer (Beckman Coulter Biotechnology (Suzhou) Co, Ltd).

Statistical methods

Statistical analysis was performed with SPSS version 13.0 (SPSS Inc., Chicago, IL), and all quantitative data are presented as the mean ± standard deviation. Differences between two groups were compared using Student’s t-test when they had a normal distribution. A one-way analysis of variance (ANOVA) was used to compare data among groups when they had a normal distribution and homogeneous variances. A p value less than 0.05 was considered statistically significant.