Animals and general procedures

H11Cas9 mice [B6J.129-Igs2tm1.1(CAG-cas9*) Mmw/J; stock #028239; laboratory of M. Winslow, Stanford University, Stanford, CA] and transgenic SOD1.G93A mice (B6.Cg-Tg(huSOD1*G93A)1Gur/J; stock #: 004435) were purchased from the Jackson Laboratory. All mice were backcrossed for at least eight generations to C57BL/6 mice. Homozygous H11Cas9 female mice and heterozygous SOD1-G93A male mice were crossed to generate H11Cas9−/+; SOD1G93A−/+ mice and age-matched H11Cas9−/+; huSOD1.G93A−/− littermates. Mice were housed in a 12/12 h light/dark cycle in a temperature-controlled room (22–24 °C) with access to food pellets and water provided ad libitum. Behavioral testing occurred between 8:00 A.M. and 5:00 P.M. For survival studies, SOD1-G93A mice were observed daily for paralysis once they reached 130 days old. The animals were sacrificed at the humane endpoint, when they were unable to right themselves within 15 s of being placed on their side, showed 20% weight loss of peak body weight or exhibited hunched posture, as directed by a veterinarian. For biochemical and histological studies, mice were euthanized at the indicated age prior to paralysis, and organs were removed and immediately frozen in liquid nitrogen or fixed in 10% neutral buffered formalin (NBF). Experimenters were blind to treatment. All animal use and treatments were approved by the Biogen Institutional Animal Care and Use Committee (IACUC) and followed the National Institute of Health Guide for the Care and Use of Laboratory Animals.

Single guide RNA (sgRNA) design, vector design and production

The eight SOD1-targeting spacer sequences of ~20 nucleotides [36] were selected based on Benchling (San Francisco, CA, USA) bioinformatic output [37, 38] against the human SOD1 gene (Table S1). Each sgRNA spacer sequence was used in combination with sgRNA scaffolds, structurally optimized for sp.Cas9 binding [39]. The sgRNAs were synthesized and cloned into the expression constructs by PackGene (Worcester, MA, USA). Each AAV construct contains a U6 promoter that drives expression of a sgRNA, and either a CBA promoter that drives expression of a green fluorescence protein (eGFP) fused with a KASH domain or a CAG promoter that drives expression of a mCherry fluorescence protein. All AAV vectors, including AAV-PHP.B and AAV-PHP.eB, were purchased from PackGene (Worcester, MA, USA).

Neonatal intracerebroventricular (ICV) injection, intrathecal injection (IT) and intravenous injection (IV) of AAV

Postnatal day 0 (P0) pups were anesthetized by hypothermia for 2–4 minutes until movement ceased. Cryo-anesthetized pups were injected with 4 μl of AAV buffered with PBS containing 0.25% of FastGreen dye into the lateral ventricle(s) (2E11 vg per mouse). Injection sites were located halfway between lambda and bregma, 1 mm lateral to the superior sagittal sinus, to a depth of 2 mm. Injections were performed with a 33-gauge, 10 µL, 45o bevel Hamilton syringe (Hamilton Company, Reno, NV, USA) inserted perpendicular to the surface of the skull. Injection efficiency was monitored by the spread of the dye throughout the lateral and the third ventricles. Mice were euthanized for tissue collection at 20 weeks of age for histological analysis, and at 5, 10 or 20 weeks of age for biochemical and genomic analysis. Animal injection, group allocation and takedown were pseudorandomized.

For intrathecal injection (IT), 5 weeks of age mice were anesthetized with isoflurane first in the chamber and then continuously anesthetized with isoflurane to maintain deep anesthesia via a nose cone throughout the procedure pad. The fur on the back of the anesthetized mice were shaved from the tail to the caudal thoracic spine and placed on a sterile sheet laid on top of a heating pad. 100 μl of AAV buffered with PBS (1E12 vg per mouse) was injected into the intrathecal space between the L3 an L4 vertebrae with a 31-gauge, 0.5 mL insulin syringe [40]. A subset of injected mice was euthanized for tissue collection at 15 weeks of age for biochemical analysis.

For IV injection, 5 weeks of age mice were placed in a restraint that positioned the mouse tail in a lighted, heated groove (Braintree Scientific, Inc). The tail was swabbed with alcohol and then injected intravenously with 100 μl of AAV buffered with PBS (1E12 vg per mouse). The sample size for all mouse experiments was an n > 6/treatment was determined from prior unpublished data.

Open field

To assess locomotor activity, mice were placed within an open field apparatus and locomotor activity was captured by video tracking software. After, mice were acclimated to the testing room for 30 min they were individually placed in a cylindrical arena (43 cm × 36 cm: d x h). An overhead camera was used to track the animals using Noldus Ethovision (version 13) for 15 min. Mice were then returned to their home cage, and the arena was thoroughly cleaned prior to the next session. Locomotor activity was assessed on a monthly basis, starting at 7 weeks of age and concluding at 43 weeks of age.

Rotarod

For the Rotarod testing, mice were placed in one of five lanes on a slowly rotating rod (Ugo Basile) 16 cm above a stainless-steel trip box. Mice were acclimated to the testing room for a minimum of 30 min prior to testing. Once the mice were placed on the rotating rod, it gradually accelerated from 5 to 40 RPM (revolutions per minute) over 5 min. When the mice fell onto the trip box, a magnetic switch was activated and the latency to fall was recorded. For each mouse there were three test trials each day with a minimum 5-min interval between test trials. After each trial the mice were returned to their home cage. Observations were recorded at 11, 15, 19, 21, 23, 25, 27, 29, 31, 35, 39, and 43 weeks of age.

Inverted grid

Mice were placed on a small, inverted metal grid 25 cm above standard shaving bedding and latency to fall was recorded. Mice were acclimated to the test room for a minimum of 30 min prior to testing. The height of the grid allowed a soft landing when the mice fell but was high enough to prevent the mice from voluntarily jumping down. The time to fall was recorded by an experimenter with a stopwatch. The trial ended when the mouse fell or remained on the grid for 240 s. Up to two trials were done each test day with a rest interval of at least 2 min between trials. The second trial was only performed if the mouse did not reach 240 s on the first trial. After each trial and upon test completion, mice were returned to their home cage. Observations were recorded at 25, 27, 31, 35, 39, and 43 weeks of age.

Clasping

Mice were observed for limb clasping each day just prior to the rotarod assessment. Mice were lifted by the base of the tail and were observed for 10 sec and then placed back into their home cage. A score was assigned based on the following 5-point scale: limbs splayed outward (away from abdomen) = 0, one limb retracted toward abdomen = 1, two limbs retracted toward abdomen = 2, three limbs retracted toward abdomen = 3, four limbs retracted toward abdomen = 4, and all limbs retracted toward abdomen and body forming a ball =5. Observations were recorded at 11, 15, 19, 21, 23, 25, 27, 29, 31, 35, 39, and 43 weeks of age.

Compound Muscle Action Potential (CMAP)

Recordings were conducted by an experimenter blinded to genotype and treatment. All measurements were performed with animals maintained under isoflurane anesthesia (1.5–2.5%) and with body temperature maintained around 37 °C. Electrophysiological responses were obtained separately from both the left and right hind limbs of each mouse; the left hind limb was always recorded before the right. The period of testing (and time during which the animal was anesthetized) lasted approximately 10 minutes. Responses were recorded at 5, 8 and 10 weeks of age, and at monthly intervals subsequently until age week 46. Disposable monopolar needle electrodes (Teca 25 mm, 28G electrodes, Natus Medical Inc., San Carlos, CA) were used for both stimulation and recording. The sciatic nerve was stimulated with constant-current monophasic square-wave pulses (0.1 ms duration) produced by a WPI (model 365A) stimulator, with timing controlled by a data acquisition interface (National Instruments USB-6343). Current was delivered via a stimulating cathode placed sub-dermally near the sciatic notch to stimulate the sciatic nerve. The recording electrode was placed 1 mm intramuscularly into the belly of the tibialis anterior muscle and the reference electrode was placed at the ankle. For each recording, stimulation was applied every 2 s with incremental current levels (beginning at 1.0 mA and increasing in 0.5 mA steps) until the CMAP amplitude stopped increasing; recordings were performed using a current level 0.5 mA above this level. This supra-maximal stimulus intensity (typically found with a current between 1.5 mA and 3.5 mA) was used to record four CMAP responses which were then averaged for analysis. The minimum and maximal values of the response waveform were measured beginning 0.8 ms after stimulation to exclude the stimulus artifact. The absolute value of these numbers was taken and then summed for the final CMAP value of a response. The final CMAP value for a given animal is the average of the left and right leg peak-to-peak amplitudes. Each animal is considered one data point for statistical purposes. CMAP data was analyzed with two-way ANOVA followed by Sidak’s multiple comparison test, P < 0.05 is considered significant.

NMJ staining and counting

Tibialis anterior muscles were dissected and fixed in 10% NBF at 4 °C for 8 h, followed by 2% paraformaldehyde [11] buffered in 0.1 M sodium phosphate at 4 °C for 16 h, and then transferred to 20% sucrose in PBS at 4 °C for 24 h for cryoprotection. Samples were shipped to Jackson Laboratory for cryo-embedding in OCT, staining and analysis. Sections (20 μm) were collected by a cryostat and mounted directed onto glass slides. Sections were incubated overnight in primary antibodies containing a cocktail of mouse monoclonal anti-neurofilament 2H3 and anti-SV2 antibodies (Developmental Studies Hybridoma Bank), washed the following day and incubated overnight with Alexa-Fluor-488 conjugated anti-mouse IgG1 and Alexa-Fluor-594 conjugated α-bungarotoxin (BTX, Invitrogen). Sections were mounted to slides in fluorescence mounting media (DAKO, S3023) and imaged on a Leica SP5 laser confocal microscope. Manual counting of NMJ was performed by blinded individuals under a microscope as innervated, partially innervated (i.e., 50% or less anti-SV2 and anti-neurofilament positive signals overlapping with anti-bungarotoxin positive signals) and denervated NMJ. A total of 970 NMJs were counted in SOD1; sgLacZ group, 1531 NMJs were counted in SOD1; sgSOD1#5 group, and 1949 NMJs were counted in WT; sgLacZ group.

Spinal motor neuron staining and quantification

Lumbar spinal cord samples were fixed in 10% NBF for 48 h, processed on the Leica Peloris tissue processor and embedded into paraffin in a transverse orientation. Samples were bisected prior to embedding, such that every block contained two segments. Sectioning was performed on a Leica rotary microtome at a 5-micron thickness. Sections were collected at 6 levels, >50 µm apart. 6 sections per animals were used for IHC staining for choline acetyltransferase (ChAT), for a total of 12 technical replicates for quantification of motor neuron counts. Immunohistochemistry was performed for ChAT to assess MN numbers. The automated Ventana Discovery Ultra staining platform was used. Briefly, slides were deparaffinized and rehydrated. All reagents were from Roche Ventana, unless stated otherwise. Epitope retrieval was performed in the CC2 buffer (pH 6.0) for 64 min, at 93 °C. Primary antibody (rabbit monoclonal anti-choline acetyltransferase, clone EPR16590, Abcam, Cat. No. ab178850) was applied at the final concentration of 2 µg/mL for 60 min at ambient temperature. Goat anti-rabbit polyclonal antibody conjugated to nitropyrazole (NP) was applied for 12 min, followed by incubation with anti-NP reagent conjugated to alkaline phosphatase for 12 min. Positive staining was visualized with Discovery Red chromogen applied for 16 min. Slides were counterstained with hematoxylin. Slides were digitized on a 3D-Histech Pannoramic-250 whole slide scanner at 200x magnification. Custom made VisioPharm algorithms were used to quantify motor neurons in the ventral horns of the spinal cord.

Tibialis muscle staining and analysis

Tibialis Anterior muscle samples were fixed in 10% NBF for 7 days, processed on the Leica Peloris tissue processor and embedded into paraffin in a transverse orientation. Samples were bisected prior to embedding, such that every block contained two segments of the muscle. Sectioning was performed on a Leica rotary microtome at a 5-micron thickness. Gomori method for staining reticulin fibers was applied. Briefly, slides were deparaffinized in a series of xylene and graded ethanol solutions, and rehydrated. Slides were incubated with the following solutions (all from Poly Scientific R&D Corp unless stated otherwise): 0.5% aqueous potassium permanganate (Cat. No. S263), 2% aqueous potassium meta-bisulfite (Cat. No. S2005), 2% aqueous ferric ammonium sulfate (Cat. No. S179), Gomori’s ammonical silver nitrate (Cat. No. S114), 10% buffered formalin (Cat. No. S185), 0.2% aqueous gold chloride (Cat. No. S202), 2% aqueous potassium meta-bisulfite (Cat. No. S2005), and 2% aqueous sodium thiosulfate (Cat. No. S280). Slides were thoroughly washed between each incubation step. All subsequent reagents were from Roche Ventana, unless stated otherwise. Epitope retrieval was performed in the CC2 buffer (pH 6.0) for 64 min at 93 °C. To block the endogenous mouse IgG and non-specific background, slides were incubated with Rodent Block M (Biocare Medical, Cat. No. RBM961) for 16 min. Slides were counterstained with hematoxylin.

Slides were digitized on a 3D-Histech Pannoramic-250 whole slide scanner at a 200x magnification. Custom made VisioPharm algorithms were used to assess the average diameter of myosin fibers.

Blood neurofilament quantification

Roughly 30 μl blood was collected by facial vein puncture at the indicated time points. Serum samples were prepared by centrifugation through BD Microtainer SST Clog Activator/Gel tubes (Becton Dickinson) and stored at −80 °C until used. Levels of pNFH in serum were measured by the ELLA microfluidic ELISA platform according to the manufacturer’s instructions (Protein Simple).

Human SOD1 ELISA analysis

Cortex or spinal cord tissues were homogenized in tissue lysis buffer [50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X, 1% Na-deoxycholate, 0.1% SDS, 8 M Urea, 5 mM EDTA, supplemented with 1 mM dithiothreitol, 1 mM phenylmethanesulfonylfluoride fluoride (Sigma, 93482), complete protease inhibitor (Roche, 04693124001), PhosSTOP phosphatase inhibitor (Roche, 4906845001), 10 mM sodium fluoride, and 1 mM sodium orthovanadate (New England Biosciences, P07585)], by using TissueLyser II (QIAGEN). Homogenates were subsequently cleared via centrifugation at 20,000 x g for 30 min. Total protein concentration of the supernatant was measured by using BCA Protein Assay Kit (Pierce). Human SOD1 protein levels were measured from lysates with equal amount of total proteins, using Human Cu/ZnSOD1 Platinum ELISA Kit according to manufacturer’s instructions (BMS222, Invitrogen).

Nuclei isolation, human SOD1 indel analysis and copy number analysis

For Cohort #1, at 5-, 10-, or 20-weeks post-injection of AAV-U6-sgRNA-CBA-eGFP-KASH, cortices and half spinal cords were dissected, snap frozen and stored at −80 °C. Frozen tissues were thawed and homogenized in 1.5 mL ice-cold homogenization buffer (HBSS, 25 mM HEPES). The homogenate was passed through a 250 µm filter and spun at 600 x g for 5 min at 4 °C. The cell pellet was gently resuspended in 1 mL FBS and subsequently in 9 mL of 33% Percoll solution (GE Healthcare, Chicago, IL, USA) containing HBSS and 16.7 mM HEPES. An additional 1 mL of 10% FBS solution containing HBSS and 22.5 mM HEPES was carefully layered onto the top of cell suspension layer containing 30% Percoll. Density gradient centrifugation was performed at 800 x g for 15 min at 4 °C (1 acceleration and 1 brake). The supernatant was removed, and the nuclei pellet was resuspended and washed in FACS buffer (HBSS, 1% BSA, 2 mM EDTA, 25 mM HEPES, 0.09% sodium azide). Half a million intact EGFP positive nuclei labeled with Vybrant DyeCycle Violet Stain (Thermo Fisher Scientific) were isolated by FACS using MoFlo Astrios EQ (Beckman Coulter, Brea, CA, USA). Genomic DNA was isolated from the sorted nuclei or total nuclei by DNeasy Blood & Tissue Kit (catalog #: 69504) according to manufacturer’s instruction (QIAGEN).

For Cohort #4, at the end of study (~45 weeks post-injection of AAV-U6-sgRNA-CBA-eGFP-KASH), cortices and half spinal cords were dissected, snap frozen and stored at −80 °C. Total genomic DNA were isolated from frozen cortices and spinal cords using DNeasy Blood & Tissue Kit (catalog #: 69504) according to manufacturer’s instruction (QIAGEN).

For human SOD1 indel analysis, primers (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagcttgctggaggttcactg-3′; 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGcacaacacccacctgctgta-3′) with Illumina adaptor (underlined) were used to amplify region of human SOD1 surrounding the sgRNA-targeted locus, using KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Wilmington, MA, USA). The library was constructed by indexing individual samples with Illumina’s Nextera XT indices (Illumina, San Deigo, CA, USA) with limited PCR cycles. The library was pooled by volume and purified using AMPure XP beads (Beckman Coulter). The final library pool was quantified by KAPA Library Quantification Kit (Kapa Biosystems) and loaded on to Illumina’s MiSeq at 10 pM for 2 × 150 bp cycle run.

For human SOD1 transgene copy number analysis, the following oligonucleotides were used for human SOD1: 5′-GGGAAGCTGTTGTCCCAAG - 3′ (primer #1); 5′- CAAGGGGAGGTAAAAGAGAGC - 3′ (primer #2); 5′-CTGCATCTGGTTCTTGCAAAACACCA - 3′ (probe conjugated with FAM). The follow oligonucleotides were used for ApoB as a reference gene with two copies per cell: 5′-CACGTGGGCTCCAGCATT - 3′ (primer #1); 5′- TCACCAGTCATTTCTGCCTTTG - 3′ (primer #2); 5′-CCAATGGTCGGGCACTGCTCAA - 3′ (probe conjugated with HEX). Oligonucleotides were purchased from IDT (Newark, NJ, USA). The ddPCR 2x Super Mix reagent (186–3010, Bio-Rad) was used for the real-time amplification, along with 5–10 ng of genomic DNA, 900 nM of primers and 250 nM of probe. Prior to thermal cycling, the reaction mixtures were further processed into droplets by QX100 Droplet Generator according to manufacturer’s instructions (1863002, Bio-Rad). After initial activation at 95 °C for 10 min, 40 PCR cycles of 96 °C for 30 s and 59 °C for 60 s were performed, followed by 98 °C for 10 min and then held at 4 °C. Amplified products in the droplets were subsequently analyzed on QX100 Droplet Reader (1863003, Bio-Rad).

Tissue culture, transfection, AAV transduction and RNA sequencing (RNAseq)

COS1 cells were purchased from ATCC (CRL-1650) and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (HI-FBS), 1% Penicillin-Streptomycin (Pen-Strep) and 2 mM L-glutamine and incubated at 37 °C and 5% CO2. FUGENE HD (Promega, San Luis Obispo, CA, USA) was used for transfection according to the manufacturer’s instructions. The expression plasmid CMV-HA-human SOD1, CMV-FLAG-Cas9 and U6-sgSOD1-CAG-mCherry were mixed in a 1:4:5 ratio in Opti-MEM media (Thermo Fisher Scientific, Waltham, MA, USA) for transfection. The transfected COS1 cells were harvested 24 h after transfection.

The inducible Neuro-2a cells expressing sp.Cas9 were purchased from GeneCopoeia and maintained in DMEM supplemented with 10% HI-FBS, 1% L-glutamine and hygromycin (100 µg/mL final) and incubated at 37 °C and 5% CO2. Neuro-2a cells were treated with doxycycline inducer at a concentration of 0.01, 0.1, or 1 µg/mL to induce expression of sp.Cas9. The expression plasmid CMV-HA-human SOD1 and U6-sgSOD1-CAG-mCherry were mixed in a 1:9 ratio in Opti-MEM media (Thermo Fisher Scientific, Waltham, MA, USA) for transfection by FUGENE HD. The transfected Neuro-2a cells were harvested 24 h after transfection.

HeLa cells stably expressing Cas9 (GeneCopoeia SL503) were cultured in DMEM, 10% FBS, 1% Pen-Strep, 1x final GlutaMAX (Thermofisher Scientific 35050061), and Hygromycin (250 µg/mL final) at 37 °C and 5% CO2. After 24 h of seeding into 24-well PDL-coated tissue culture plates (Corning 354470), cells were transduced with AAV-PHP.B-sgLacZ and AAV-PHP.B-sgSOD1#5 at 1000k MOI (multiplicity of infection) for 48 h or 72 h. The cells were then harvested in QIAzol (Qiagen 79306) for RNA extraction using miRNeasy mini kit (Qiagen 217004). For bulk RNAseq, 250 ng of extracted RNA was used to prepare RNAseq libraries using the Kapa mRNA hyperprep kit (Kapa biosystems KK8581), following the manufactures instructions. Fragmentation of mRNA was carried out for 6 min at 94 °C, followed by RT, A-tailing, adaptor ligation, and 12 cycles of PCR, to produce Illumina sequencing libraries. Tagged libraries were pooled and sequenced on an Illumina NovaSeq6000 sequencer with a run parameter of 2 × 51 bp paired end reads. Quality control was performed using Illumina’s BaseSpace run summary tool, which showed a %Q30 of 94.14%. The fastq files were generated from the bcl files using bcl2fastq v2.20 (Illumina). The RNA-seq analysis pipeline consisted of alignment with STAR version 2.5.2a against human genome version GRCh38 and Gencode gene model release 27 [41, 42]. After alignment, quantification of gene expression was carried out with RSEM v1.2.26 [43]. Data quality metrics and plots for visualization were generated with Quickomics [44]. Differential expression analysis was performed with DESeq2 version 1.30.0 [45]. The function apeglm was used for LFC shrinkage to reduce noise and preserve large differences [46]. Cutoff values used for significant differential expression were fold change >2 and adjusted p-value < 0.05.

Immunoblotting and antibodies

For the detection of protein expression in total cell lysates, cells were lysed in Novex Tris-Glycine SDS sample buffer containing NuPAGE sample reducing agent (Invitrogen). Lysates were electrophoresed through Novex Tris-Glycine gels or NuPAGE Bis-Tris gels, transferred to nitrocellulose membranes, and subjected to immunoblot analysis. The blocking of membranes and subsequent antibody incubations were performed using Odyssey blocking buffer (LI-COR Biosciences) according to the manufacturer’s instructions. Primary antibodies against β-Tubulin (926–42211, LI-COR Biosciences), β-actin (926–42210, LI-COR Biosciences), FLAG (F1804, Millipore Sigma, Burlington, MA), mCherry (ab167453, Abcam, Cambridge, United Kingdom), GAPDH (ab8245, Abcam), and human SOD1 (ADI-SOD1–100, Enzo) were purchased from commercial sources. The IRDye 800CW-conjugated and IRDye 680-conjugated secondary antibodies were obtained from LI-COR Biosciences. Immunoblot signals were visualized by the Odyssey CLx infrared imaging system and quantified by ODYSSEY application software (LI-COR Biosciences).