Conceptualization, Q.Y., Y.Z. and W.X.; formal analysis, Y.H., D.Y., S.Z., T.J., J.X., H.L., W.W. and Q.G.; investigation, H.W., L.W., H.F. and H.Z.; writing—original draft preparation, Y.H.; writing—review and editing, Q.Y., Y.Z. and W.X.; supervision, Q.Y. and Y.Z.; project administration, Q.Y. and Y.Z.; funding acquisition, Y.Z. All authors have read and agreed to the published version of the manuscript.
Figure 1. Maximum likelihood phylogenetic tree based on the entire VP1 nucleotide coding region sequences (849bp). Notes: Regions marked in red indicate the sequences isolated in this study. The red quadrilateral represents the prototype strain.
Figure 1. Maximum likelihood phylogenetic tree based on the entire VP1 nucleotide coding region sequences (849bp). Notes: Regions marked in red indicate the sequences isolated in this study. The red quadrilateral represents the prototype strain.
Figure 2. Temporal phylogenetic development of CVB5. (A) A histogram based on the weekly square count of different provinces. (B) Markov chain Monte Carlo (MCC) phylogeny tree based on the entire VP1 coding area in China, colored according to different geographical partitions.
Figure 2. Temporal phylogenetic development of CVB5. (A) A histogram based on the weekly square count of different provinces. (B) Markov chain Monte Carlo (MCC) phylogeny tree based on the entire VP1 coding area in China, colored according to different geographical partitions.
Figure 3. Spatiotemporal dynamics of CVB5 in China. The arrows between the locations indicate the migration route of CVB5. Only the propagation path with BF ≥ 3 is shown.
Figure 3. Spatiotemporal dynamics of CVB5 in China. The arrows between the locations indicate the migration route of CVB5. Only the propagation path with BF ≥ 3 is shown.
Figure 4. A total of 53 CVB5 isolates were analyzed with phylogenetic trees of enterovirus (EV-B) prevalent strains downloaded from GenBank. Notes: (A) 5′-untranslated region, (B) P1 capsid region, (C) P2 non-capsid region, and (D) P3 non-capsid region and the recombinant lineages are differentiated by distinct colors. The red triangle indicates the CVB5 prototype strain.
Figure 4. A total of 53 CVB5 isolates were analyzed with phylogenetic trees of enterovirus (EV-B) prevalent strains downloaded from GenBank. Notes: (A) 5′-untranslated region, (B) P1 capsid region, (C) P2 non-capsid region, and (D) P3 non-capsid region and the recombinant lineages are differentiated by distinct colors. The red triangle indicates the CVB5 prototype strain.
Figure 5. Recombination analysis of CVB5 genotypes. (A) Average pairwise diversity based on 53 full-length genome sequences of all genotypes and genotypes B and D. Each lineage is shown using a sliding window of 200nt with a step of 20nt. (B) Recombination breakpoints based on the whole genomes of different lineages as detected within genotypes. (C) Genomic mapping of representative strain recombination events predicted using RDP4 software for CVB5.
Figure 5. Recombination analysis of CVB5 genotypes. (A) Average pairwise diversity based on 53 full-length genome sequences of all genotypes and genotypes B and D. Each lineage is shown using a sliding window of 200nt with a step of 20nt. (B) Recombination breakpoints based on the whole genomes of different lineages as detected within genotypes. (C) Genomic mapping of representative strain recombination events predicted using RDP4 software for CVB5.
Figure 6. The maximum clade credibility tree of CVB5 worldwide. Geographic locations are abbreviated as follows: BLR: Belarus, FRA: France, FIN: Finland, DEN: Denmark, EST: Estonia, GER: Germany, HUN: Hungary, ITA: Italy, GBR: the United Kingdom, NED: Netherlands, POL: Poland, ROM: Romania, RUS: Russia, SUI: Suisse, CYP: Cyprus, CHN: China, IND: India, JPN: Japan, KGZ: Kyrgyzstan, KWI: Kuwait, PAK: Pakistan, THA: Thailand, TUR: Turkey, KOR: Chesapeake, BRA: Brazil, ECU: Ecuador, HON: Honduras, COM: Comoros, USA: United States, AUS: Australia.
Figure 6. The maximum clade credibility tree of CVB5 worldwide. Geographic locations are abbreviated as follows: BLR: Belarus, FRA: France, FIN: Finland, DEN: Denmark, EST: Estonia, GER: Germany, HUN: Hungary, ITA: Italy, GBR: the United Kingdom, NED: Netherlands, POL: Poland, ROM: Romania, RUS: Russia, SUI: Suisse, CYP: Cyprus, CHN: China, IND: India, JPN: Japan, KGZ: Kyrgyzstan, KWI: Kuwait, PAK: Pakistan, THA: Thailand, TUR: Turkey, KOR: Chesapeake, BRA: Brazil, ECU: Ecuador, HON: Honduras, COM: Comoros, USA: United States, AUS: Australia.
Figure 7. Amino acid mutation in the VP1 region of CVB5.
Figure 7. Amino acid mutation in the VP1 region of CVB5.
Table 1. Primers used for the full-length genomic sequencing of CVB5.
Table 1. Primers used for the full-length genomic sequencing of CVB5.
PrimerNucleotide Position (nt)Sequence (5′-3′)OrientationReference0001S48 GGGGACAAGTTTGTACAAAAAAGCAGGCTTTForward[18]338F338–1182GTTTCGTTCAGCACAACCCCForwardThis study1134R1134–1383TCAGGCTCTTCTGGTCAGGTReverseThis study1115F1350–2050ACCTGACCAGAAGAGCCTGAForwardThis study2713R1949–2968CCTTCTGTCCAGAACACGCTReverseThis study4902226–2248TGIGTIYTITGYRTICCITGGATForward[17]4912883–2902ATGTAYRTICCICCIGGNGG Forward[17]4922953–2934GGRTTIGTIGWYTGCCA Reverse[17]4933641–3622TCNACIANICCIGGICCYTCReverse[17]2183F2183–3550CTTCTACCAAGGGCCCACAGForwardThis study3942R3250–3942GCTTGAGCCTGGTCAGGAATReverseThis study3350F3350–4360AAACTGCGTGTGGGAGGATTForwardThis study4450R3650–4450GCCCGATTAGATTGGTGGCTReverseThis study3935F3935–5000GCTCAAGCAACTCCCACTTCForwardThis study4825R4825–5100GGGATTTCAGGTGCAACACTReverseThis study4605F4605–5830TGTTGCCCAGTCAATTTCAAForwardThis study5579R5579–6730TACCTTGCCGGTACACATGAReverseThis study5600F5600–6580GACACTGCTGAAACTCAACCGForwardThis study6500R6500–6880GTCTGGATTTCCCTTTTGCCACReverseThis study5991F5991–6730TTGACAACAAGTGCGGGATAForwardThis study6900R6240–6900CGTGGTCTTGGGTGTTCTTTReverseThis study6758F6758–6940CTTTGTGCGTGGTGGTATGCForwardThis study7380R6900–7380CCCTACCGCACCGTTATCAAReverseThis study7500AGGGGACCACTTTGTACAAGAAAGCTGGG(T)24Reverse[19]
留言 (0)