記住我
Figure 1. Evaluation of EMT markers and matrix effectors in LoVo-S and LoVo-R cells. Cells were cultured for 24 h on a Millipore filter with 5 µm pores in the presence of matrix substrates (Matrigel and collagen) at different concentrations (0.2 and 3.5 mg/mL). In LoVo-S cells, E-cadherin (A,B using RT-PCR and western blot, respectively), Snail, MMP-2, -9, and -14 gene expressions were highly increased in concentrated collagen substrate (3.5 mg/mL) (D–G). Both in Matrigel and type I collagen cultures of LoVo-S cells, the HPSE expression depends on substrate concentration and is independent of substrate type (H). In LoVo-R cells, E-cadherin, vimentin, Snail, MMP-2, and -14 expressions are independent of both the type and concentration of the substrate (A–E,G,H). Both in Matrigel and type I collagen culture LoVo-R cells, MMP-9 expression depends on substrate concentration and is independent of substrate type (F). Bars represent the mean ± standard deviation (SD). The gene expression was normalized to GAPDH as a housekeeping gene. # p ≤ 0.05; ## p ≤ 0.001. Statistical analyses were performed using the Relative Expression Software Tool (REST).
Figure 1. Evaluation of EMT markers and matrix effectors in LoVo-S and LoVo-R cells. Cells were cultured for 24 h on a Millipore filter with 5 µm pores in the presence of matrix substrates (Matrigel and collagen) at different concentrations (0.2 and 3.5 mg/mL). In LoVo-S cells, E-cadherin (A,B using RT-PCR and western blot, respectively), Snail, MMP-2, -9, and -14 gene expressions were highly increased in concentrated collagen substrate (3.5 mg/mL) (D–G). Both in Matrigel and type I collagen cultures of LoVo-S cells, the HPSE expression depends on substrate concentration and is independent of substrate type (H). In LoVo-R cells, E-cadherin, vimentin, Snail, MMP-2, and -14 expressions are independent of both the type and concentration of the substrate (A–E,G,H). Both in Matrigel and type I collagen culture LoVo-R cells, MMP-9 expression depends on substrate concentration and is independent of substrate type (F). Bars represent the mean ± standard deviation (SD). The gene expression was normalized to GAPDH as a housekeeping gene. # p ≤ 0.05; ## p ≤ 0.001. Statistical analyses were performed using the Relative Expression Software Tool (REST).
Figure 2. Ultrastructural morphology of LoVo-S and LoVo-R cells cultured for 24 h on a Millipore filter. LoVo-S cells show grouped flattened cells but also globular ones. All of them display cell-cell contacts. A number of cells (6%) exhibit a concave conic/funnel shape (arrows) when trying to pass through the Millipore pores (A,B). All cells show few microvilli and no microvesicles on their surface (C). LoVo-R cells look like smooth, regular, and very flattened cobblestone-shaped cells. They appear next to each other but do not show tight cell-cell contacts. A tilted observation demonstrates that they appear like concave leaves and develop filopodia (arrows) crossing the pores of the Millipore filter (D–F). Bar = 100 µm (A,D). Bar = 10 µm (B,C,E,F).
Figure 2. Ultrastructural morphology of LoVo-S and LoVo-R cells cultured for 24 h on a Millipore filter. LoVo-S cells show grouped flattened cells but also globular ones. All of them display cell-cell contacts. A number of cells (6%) exhibit a concave conic/funnel shape (arrows) when trying to pass through the Millipore pores (A,B). All cells show few microvilli and no microvesicles on their surface (C). LoVo-R cells look like smooth, regular, and very flattened cobblestone-shaped cells. They appear next to each other but do not show tight cell-cell contacts. A tilted observation demonstrates that they appear like concave leaves and develop filopodia (arrows) crossing the pores of the Millipore filter (D–F). Bar = 100 µm (A,D). Bar = 10 µm (B,C,E,F).
Figure 3. LoVo-S and LoVo-R were cultivated for 24 h on a Millipore filter with 5 µm pores covered by Matrigel at standard concentration mimicking the BM. LoVo-S cells show large and very flattened polygonal cells (10–20 µm) in tight contact with each other, but also a few globular ones (10 µm in diameter), which grow on the flattened ones (A). Sparse microvilli and a few vesicles are observable on their surface (B,C). Only a few (ca 3%) of the polygonal cells developed a conic/funnel shape, which suggests they were trying to invade the Matrigel (B). All LoVo-R cells appear like grouped cobblestone-shaped cells (10–20 µm) with a very flattened upper cytoplasmic surface and no tight contacts as an intercellular space wide 2–5 µm are always visible. Densely distributed microvilli and microvesicles are evident on their cytoplasmic surface. (D–F). Bar = 100 µm (A,D) Bar = 10 µm (B,C,E,F).
Figure 3. LoVo-S and LoVo-R were cultivated for 24 h on a Millipore filter with 5 µm pores covered by Matrigel at standard concentration mimicking the BM. LoVo-S cells show large and very flattened polygonal cells (10–20 µm) in tight contact with each other, but also a few globular ones (10 µm in diameter), which grow on the flattened ones (A). Sparse microvilli and a few vesicles are observable on their surface (B,C). Only a few (ca 3%) of the polygonal cells developed a conic/funnel shape, which suggests they were trying to invade the Matrigel (B). All LoVo-R cells appear like grouped cobblestone-shaped cells (10–20 µm) with a very flattened upper cytoplasmic surface and no tight contacts as an intercellular space wide 2–5 µm are always visible. Densely distributed microvilli and microvesicles are evident on their cytoplasmic surface. (D–F). Bar = 100 µm (A,D) Bar = 10 µm (B,C,E,F).
Figure 4. Ultrastructural morphological features of LoVo-S and LoVo-R cells cultivated for 24 h on Millipore/concentrated Matrigel mimicking a thick basement membrane. LoVo-S cells appeared as thick polygonal-like cells, but many globular ones adhering to the substrate were present. Some conic/funnel-shaped cells (ca 4%) are visible (arrows) (A). Matrigel substrate appears continuous and completely fills the Millipore pores (A,B). Cells exhibit microvilli on the cytoplasmic surface (B,C). LoVo-R cells, on the other hand, show both grouped polygonal or globular cells (ca 60–65%, p < 0.05) with few tight contacts and many microvilli and vesicles on their cytoplasmic surface (D–F). Matrigel substrate completely fills the filter pores (D,E). Among two adjacent cells with many microvilli and microvesicles, an intercellular tunneling nanotube with exosomes and microvesicles on its cytoplasmic surface is visible (F). Bar = 100 µm (A,D). Bar = 10 µm (B,C,E,F).
Figure 4. Ultrastructural morphological features of LoVo-S and LoVo-R cells cultivated for 24 h on Millipore/concentrated Matrigel mimicking a thick basement membrane. LoVo-S cells appeared as thick polygonal-like cells, but many globular ones adhering to the substrate were present. Some conic/funnel-shaped cells (ca 4%) are visible (arrows) (A). Matrigel substrate appears continuous and completely fills the Millipore pores (A,B). Cells exhibit microvilli on the cytoplasmic surface (B,C). LoVo-R cells, on the other hand, show both grouped polygonal or globular cells (ca 60–65%, p < 0.05) with few tight contacts and many microvilli and vesicles on their cytoplasmic surface (D–F). Matrigel substrate completely fills the filter pores (D,E). Among two adjacent cells with many microvilli and microvesicles, an intercellular tunneling nanotube with exosomes and microvesicles on its cytoplasmic surface is visible (F). Bar = 100 µm (A,D). Bar = 10 µm (B,C,E,F).
Figure 5. Morphology of LoVo-S and LoVo-R cells cultured for 24 h on Millipore/type I collagen mimicking the normal lamina propria. Grouped LoVo-S cells include polygonal and some elongated cells (narrow arrows) but also globular ones growing on the firsts and appearing in tight contact one to each other so as to seem like to be fused together (large arrows) (A–C). The cells exhibit microvilli but few microvesicles (B,C). LoVo-R cells look like polygonal and partially flattened shaped cells with no tight cell-cell contact and prepare themselves to invade the collagen substrate by developing a concave cobblestone shape (D,E). All the cells clearly include microvilli (E,F). Bar = 100 µm (A,D). Bar = 10 µm (B,C,E,F).
Figure 5. Morphology of LoVo-S and LoVo-R cells cultured for 24 h on Millipore/type I collagen mimicking the normal lamina propria. Grouped LoVo-S cells include polygonal and some elongated cells (narrow arrows) but also globular ones growing on the firsts and appearing in tight contact one to each other so as to seem like to be fused together (large arrows) (A–C). The cells exhibit microvilli but few microvesicles (B,C). LoVo-R cells look like polygonal and partially flattened shaped cells with no tight cell-cell contact and prepare themselves to invade the collagen substrate by developing a concave cobblestone shape (D,E). All the cells clearly include microvilli (E,F). Bar = 100 µm (A,D). Bar = 10 µm (B,C,E,F).
Figure 6. Ultrastructural morphological characteristics of LoVo-S and LoVo-R cells cultured for 24 h on Millipore/type I collagen mimicking a desmoplastic lamina propria. LoVo-S cells include polygonal cells in tight cell-cell contact with each other and adhering to the collagen fibrils, which are only partially visible. However, globular-shaped cells grow on the flattened ones (A,B). A funnel-shaped cell is detectable (arrow) (B). LoVo-S cells show few microvilli, but exosomes and microvesicles are embedded in the collagen fibril network (C). The LoVo-R cells look like globular-shaped cells next to each other, but no tight contacts are visible, so collagen fibrils are always distinguishable (D). A funnel-shaped cell is detectable (arrow) (E). The LoVo-R cells develop many microvesicles on their surface and appear strongly adherent to the fibrils with also filopodia invaginating the micropores of the collagen fibril network (E,F). Bar = 100 µm (A,D) Bar = 10 µm (B,C,E,F).
Figure 6. Ultrastructural morphological characteristics of LoVo-S and LoVo-R cells cultured for 24 h on Millipore/type I collagen mimicking a desmoplastic lamina propria. LoVo-S cells include polygonal cells in tight cell-cell contact with each other and adhering to the collagen fibrils, which are only partially visible. However, globular-shaped cells grow on the flattened ones (A,B). A funnel-shaped cell is detectable (arrow) (B). LoVo-S cells show few microvilli, but exosomes and microvesicles are embedded in the collagen fibril network (C). The LoVo-R cells look like globular-shaped cells next to each other, but no tight contacts are visible, so collagen fibrils are always distinguishable (D). A funnel-shaped cell is detectable (arrow) (E). The LoVo-R cells develop many microvesicles on their surface and appear strongly adherent to the fibrils with also filopodia invaginating the micropores of the collagen fibril network (E,F). Bar = 100 µm (A,D) Bar = 10 µm (B,C,E,F).
Figure 7. Effects of different substrates on gene expression and morphological phenotype in Lovo-S/-R cells. The green arrows show an increase in the EMT markers or matrix-degrading enzymes, whereas the red one means a decrease in the mesenchymal marker vimentin. Grey zones represent no-significant differences among the different substrates.
Figure 7. Effects of different substrates on gene expression and morphological phenotype in Lovo-S/-R cells. The green arrows show an increase in the EMT markers or matrix-degrading enzymes, whereas the red one means a decrease in the mesenchymal marker vimentin. Grey zones represent no-significant differences among the different substrates.
Table 1. List of real-time qPCR primers used in this study.
Table 1. List of real-time qPCR primers used in this study.
GenePrimer SequenceE-CadherinF: TTCTGCTGCTCTTGCTGTTT,
留言 (0)