Cell culture

Human lens epithelial B3 (HLE-B3) cells were donated by Dr. Cui from the Second Affiliated Hospital of Zhejiang University and cultured in MEM (41,500,034, Gibco) supplemented with 10% fetal bovine serum (FBS, 10,099-141C, Gibco), and 1% penicillin/streptomycin (15,140–122, Gibco) at 37℃ in a humified incubator with 5% CO2.

TGF-β2 treatment, blue light exposure, and treatment with autophagy modulating reagents

When cells reached 50 ~ 60% confluence, HLECs-B3 cells were treated with different concentrations of TGF-β2 (0, 2, 5, and 10 ng/mL, Peprotech) for 48 h, and the expression of Fibronectin, N-Cadherin, Vimentin, p62 and LC3 could be detected. Similarly, while 50% confluence, cells were treated with 5 ng/mL TGF-β2, or exposed to blue LED light, or exposed to blue light following treatment with 5 ng/mL TGF-β2 for 48 h. The blue light illuminating systems (Honyar Electrical Co., Hangzhou, China) was installed under the incubator partition with 458 nm wavelength at 0.50 mW/cm2. Finally, as an autophagy activator or autophagy inhibitor, rapamycin (200 nM, APExBIO) and chloroquine (CQ, 50 μM, APExBIO) were added to the cells for pre-treatment, in combination with or without TGF-β2 or/and blue light for 48 h.

Western blot analysis

Total proteins were harvested in ice with RIPA buffer (89,900, Thermo Fisher) supplemented with protease inhibitor cocktail (HY-k0010, MCE) and quantified using BCA assay (P0009, Beyotime). Subsequently, 20 μg of the proteins were electrophoresed by 10% SDS-PAGE (1,610,183, Bio-Rad) and then transferred onto PVDF membranes (IPVH00010, Millipore) using a Trans-Blot Turbo transfer system (Bio-Rad). Membranes were blocked with 5% nonfat milk at room temperature and cut into different strips according to the position of the marker. Then different strips were accordingly incubated with indicated primary antibodies at 4 °C overnight. The next day, membranes were probed with HRP-conjugated secondary antibody (1:5000, 7074P2, CST) at room temperature. Protein bands were visualized using hypersensitive ECL kit (BL523B-2, Biosharp) on a Bio-Rad imaging system and analyzed with ImageJ software. The primary antibodies used were diluted with primary antibody dilution Buffer (P0023A, Beyotime) containing anti-Fibronectin (1:1000, ab32417, Abcam), anti-N-cadherin (1:1000, 13,116, CST), anti-Vimentin (1:1000, 5741, CST), anti-p62/STSQM1 (1:10,000, ab109012, Abcam), and anti-LC3B (1:1000, 3868, CST), anti-GAPDH (1:3000, 5174S, CST).

RNA extraction and qRT-PCR

Total RNA from cells was extracted using Trizol reagent (9109, Takara), and one-step reverse transcription polymerase chain reaction (RT-PCR) kit (RR036A, Takara) as employed to synthesize cDNA. Fibronectin, N-Cadherin and Vimentin expression was measured using SYBR green reagent (RR091A, Takara) on QuantStudioTM Dx Real-Time PCR System (ABI) and β-actin was designated as an internal reference. Relative gene expression was determined using the 2−△△Ct method.

The following primers were used:

Gene Forward (5’ to 3’) Reverse (5’ to 3’) β-actin ATTGGCAATGAGCGGTTC GGATGCCACAGGACTCCA Fibronectin CGGTGGCTGTCAGTCAAAG AAACCTCGGCTTCCTCCATAA N-cadherin AGCCAACCTTAACTGAGGAGT GGCAAGTTGATTGGAGGGATG Vimentin AGTCCACTGAGTACCGGAGAC CATTTCACGCATCTGGCGTTC Transwell migration assay

Cell migration and invasion capacities were detected using transwell chambers (3422, Corning). Cells in serum-free medium were seeded into the upper chamber of a 24-transwell plate with 8 μm pore filter. MEM contained 20% FBS was added in the lower chambers. After treatment for 48 h, the cells that moved through the underside of the membrane filter were fixed with 4% paraformaldehyde (PFA, BL539A, Biosharp) and stained using 0.1% crystal violet (C0121, Beyotime). Then, images were photographed under an inverted microscope (Olympus), and the number of migrated cells stained were counted blindly in five random fields.

Wound healing assay

The LECs were seeded in 6-well plates (5 × 105 cells per well) and then treated as previously described when the cell density reached 90% to 100% confluence. The cell monolayers were scratched with a 200 μl pipette tip, followed by removal of the detached cells and debris with PBS. After cultured in serum-free MEM for 0, 6, 24, and 48 h, the representative images of wounds in each well were captured under a microscope. The length of the remaining wound in each image was measured and analyzed using ImageJ software.

Immunofluorescent staining

The human LCEs were seeded on 24-well plates (2 × 104 cells per well) with cell-climbing slices. After treatment as previously described, the cells were fixed with 4% PFA and permeabilized with 0.1% Triton X‐100. Then, cells were blocked with 5% BSA for 30 min at room temperature and incubated with indicated primary antibodies in a wet chamber at 4 °C overnight. Slides were then incubated with Alexa Fluor 594-conjugated secondary antibody (1:200, 112–585-003, Jackson ImmunoResearch) at room temperature for 1 h. Subsequently Nuclei were counterstained with DAPI (BL105A, Biosharp) and the cell-climbing slices were sealed. Fluorescence images were acquired using a IX71 microscope (Olympus). The primary antibodies used were following: anti-p62 (1:200, ab109012, Abcam), anti-LC3B (1:100, 3868, CST), anti-Ki67 (1:200, ab15580, Abcam).

Transmission electron microscopy (TEM) analysis

After fixation overnight with 2.5% glutaraldehyde at 4℃, the treated cells were washed in PBS and post fixed in 1% osmium tetroxide (OsO4). The cells were then dehydrated in ethanol and acetone, and embedded in EPON resin. Ultrathin Sects. (60–80 nm) were stained with acetic acid uranium and then collected on naked copper grids to be visualized under a TEM system.

Cell viability assay

The HLE-B3 cells were cultured at a density of 5,000 cells per well in 96-well plates. After treatment, cell viability was monitored using a CCK8 kit (BS350A, Biosharp) following manufacturer’s instructions. Briefly, the conditional medium was replaced with fresh serum-free media containing 10% CCK-8 and the cells incubated for 1 h at 37℃ in the dark. Absorbance at 450 nm was detected using SpectraMax i3x microplate reader (Molecular Devices).

5-Ethynyl-2′-deoxyuridine (EdU) assay

EdU assay (C0071S, Beyotime) was conducted to investigate cell proliferation following manufacturer’s instructions. Briefly, half of the medium was replaced with fresh medium containing 20 μM EdU. Thus, the treated cells were incubated with 10 μM EdU for 2 h at 37 °C and then fixed with 4% PFA at room temperature. Following permeabilized with 0.3% Triton X-100 and washed with PBS, staining reactions were performed in dark for 30 min according to the manufacturer's protocol. Subsequently cells were incubated with Hoechst 33,342 for 10 min at room temperature. The EdU positive cells were visualized under a fluorescence microscope (Olympus) and then analyzed using ImageJ software.

Statistical analysis

All data are presented as the mean ± SD of at least three independent experiments. Data analysis was done for variance on GraphPad Prism 8.0 and SPSS25.0 software. Multiple group comparisons were analyzed by one-way analysis of variance. P < 0.05 was considered to indicate a statistically significant difference.