Figure 1. Expression and activity characterization of SIRT1-APEX2 recombinant protein. HEK 293T cells were transfected with SIRT1-APEX2 (>50% transfection efficiency) and labeled. Cells were then lysed, separated by SDS-PAGE and analyzed by blotting with streptavidin-horseradish peroxidase. (A) A schematic drawing of the SIRT1-APEX2 constructs. SIRT1 gene (light green) was ligated to 5′ end of APEX2 (pink) with a V5 tag (blue). (B) Analysis of recombinant protein expression by SIRT1-APEX2 in HEK 293T cells. (C) Scheme showing APEX2-catalyzed biotinylation. Live cells are incubated with biotin-phenol (BP) probe (yellow B = biotin) for 30 min and then treated for 1 min with 1 mM H2O2 to initiate biotinylation. APEX2 catalyzes the one-electron oxidation of biotin-phenol into a biotin-phenoxyl radical, which covalently tags proximal endogenous proteins. (D) Characterization of APEX2 mediated biotinylation of endogenous proteins by streptavidin blotting. Negative controls in which resveratrol, BP and H2O2 or SIRT1-APEX2 were omitted. The β-actin and Coomassie brilliant blue staining were used as loading controls. The pooled data were shown here as mean ± SEM, and the significant differences from control cells were shown in p < 0.01 (**). The independent experiments were repeated at least three times.

Figure 1. Expression and activity characterization of SIRT1-APEX2 recombinant protein. HEK 293T cells were transfected with SIRT1-APEX2 (>50% transfection efficiency) and labeled. Cells were then lysed, separated by SDS-PAGE and analyzed by blotting with streptavidin-horseradish peroxidase. (A) A schematic drawing of the SIRT1-APEX2 constructs. SIRT1 gene (light green) was ligated to 5′ end of APEX2 (pink) with a V5 tag (blue). (B) Analysis of recombinant protein expression by SIRT1-APEX2 in HEK 293T cells. (C) Scheme showing APEX2-catalyzed biotinylation. Live cells are incubated with biotin-phenol (BP) probe (yellow B = biotin) for 30 min and then treated for 1 min with 1 mM H2O2 to initiate biotinylation. APEX2 catalyzes the one-electron oxidation of biotin-phenol into a biotin-phenoxyl radical, which covalently tags proximal endogenous proteins. (D) Characterization of APEX2 mediated biotinylation of endogenous proteins by streptavidin blotting. Negative controls in which resveratrol, BP and H2O2 or SIRT1-APEX2 were omitted. The β-actin and Coomassie brilliant blue staining were used as loading controls. The pooled data were shown here as mean ± SEM, and the significant differences from control cells were shown in p < 0.01 (**). The independent experiments were repeated at least three times.

Figure 2. Proteomics analysis of activated SIRT1 interactome. (A) Workflow of SIRT1 interactions involving samples preparation and mass spectrometry analysis. (B) PCA analysis. SVD with imputation was used to calculate principal components. X and Y axis showed principal component 1 and principal component 2 that explain 24.3% and 19.5% of the total variance, respectively. N = 9 data points. NC: negative control. CTR: control. Res: resveratrol. (C) Heatmap. (D) Enrichment of the expressed genes at the secondary GO Term in a significantly up-regulated or significantly down-regulated expression. The abscissa was the number of genes. The ordinate was the GO Term. (E) Enriched terms visualized in bubble plot. Each bubble represents an enriched function, and the size of the bubble from small to large: [0.05, 1], [0.01, 0.05), [0.001, 0.01), [0.0001, 0.001), [1 × 10−10, 0.0001), [0, 1 × 10−10). The color of the bar is the same as the color in the circular network, which represents different clusters. For each cluster, if there are more than 5 terms, the top 5 with the highest enrich ratio were displayed. (F) Dramatic changes of biotinylated proteins were visualized by string database. The biotinylated protein level reduced by resveratrol was filled in green; the increased level was filled in red. The size of the circle and depth of color indicate the fold changes, the larger circles and deeper colors mean a higher fold change.

Figure 2. Proteomics analysis of activated SIRT1 interactome. (A) Workflow of SIRT1 interactions involving samples preparation and mass spectrometry analysis. (B) PCA analysis. SVD with imputation was used to calculate principal components. X and Y axis showed principal component 1 and principal component 2 that explain 24.3% and 19.5% of the total variance, respectively. N = 9 data points. NC: negative control. CTR: control. Res: resveratrol. (C) Heatmap. (D) Enrichment of the expressed genes at the secondary GO Term in a significantly up-regulated or significantly down-regulated expression. The abscissa was the number of genes. The ordinate was the GO Term. (E) Enriched terms visualized in bubble plot. Each bubble represents an enriched function, and the size of the bubble from small to large: [0.05, 1], [0.01, 0.05), [0.001, 0.01), [0.0001, 0.001), [1 × 10−10, 0.0001), [0, 1 × 10−10). The color of the bar is the same as the color in the circular network, which represents different clusters. For each cluster, if there are more than 5 terms, the top 5 with the highest enrich ratio were displayed. (F) Dramatic changes of biotinylated proteins were visualized by string database. The biotinylated protein level reduced by resveratrol was filled in green; the increased level was filled in red. The size of the circle and depth of color indicate the fold changes, the larger circles and deeper colors mean a higher fold change.

Figure 3. Interaction of SIRT1–RanGap1 and SIRT1–G3BP1 occurs in 2 epithelial cell lines. (A,C) SIRT1 interacts with RanGap1 and G3BP1 in HEK 293T cells. (B,D) SIRT1 interacts with RanGap1 and G3BP1 in MCF-7 cells. The independent experiments were repeated at least three times. IgG was used as a negative control.

Figure 3. Interaction of SIRT1–RanGap1 and SIRT1–G3BP1 occurs in 2 epithelial cell lines. (A,C) SIRT1 interacts with RanGap1 and G3BP1 in HEK 293T cells. (B,D) SIRT1 interacts with RanGap1 and G3BP1 in MCF-7 cells. The independent experiments were repeated at least three times. IgG was used as a negative control.

Figure 4. SIRT1 regulates RanGap1 expression. After treating with 20 μM resveratrol for 24 h, or having SIRT1 over-expressed or knocked down in HEK 293T cells, the relative mRNA levels were determined by RT-PCR and the protein levels were detected by Western blot. (A) SUMO1-RanGap1 was increased after activation of SIRT1. (B) SUMO1-RanGap1 was increased in SIRT1-OE cells. (C) RanGap1 was decreased in SIRT1-KD cells. (D–F) The mRNA levels of SIRT1, RanGap1, G3BP1, FASN, UBE2M, Ran, LDHB, TCP1, LMNB1, HIST1H4A and PARP1 from cells as above. The GAPDH was used as a loading control. The pooled data were shown here as the mean ± SEM, and the significant differences from control cells were shown in p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***). The independent experiments were repeated at least three times.

Figure 4. SIRT1 regulates RanGap1 expression. After treating with 20 μM resveratrol for 24 h, or having SIRT1 over-expressed or knocked down in HEK 293T cells, the relative mRNA levels were determined by RT-PCR and the protein levels were detected by Western blot. (A) SUMO1-RanGap1 was increased after activation of SIRT1. (B) SUMO1-RanGap1 was increased in SIRT1-OE cells. (C) RanGap1 was decreased in SIRT1-KD cells. (D–F) The mRNA levels of SIRT1, RanGap1, G3BP1, FASN, UBE2M, Ran, LDHB, TCP1, LMNB1, HIST1H4A and PARP1 from cells as above. The GAPDH was used as a loading control. The pooled data were shown here as the mean ± SEM, and the significant differences from control cells were shown in p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***). The independent experiments were repeated at least three times.

Figure 5. RanGap1 affects antioxidant capacity and mitochondrial functions. (A) The ROS level was decreased in SIRT1-KD cells and increased in SIRT1-OE cells. (B) The ROS level was increased in RanGap1-OE cells and did not have obvious changes in RanGap1-KD cells. (C) PGC1-α, Drp1, PINK1 and TFAM were decreased, and Mfn1 and Parkin were increased in RanGap1-KD cells. (D) PGC1-α, Drp1, Mfn1, PINK1 and TFAM were increased in RanGap1-OE cells. (E) The cell viability was significantly decreased in RanGap1-OE cells under treating with 30 to 50 μM resveratrol compared to control cells. DMSO was used as negative control. The GAPDH was used as a loading control. The pooled data were shown here as the mean ± SEM, and the significant differences from control cells were shown in p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***). The independent experiments were repeated at least three times.

Figure 5. RanGap1 affects antioxidant capacity and mitochondrial functions. (A) The ROS level was decreased in SIRT1-KD cells and increased in SIRT1-OE cells. (B) The ROS level was increased in RanGap1-OE cells and did not have obvious changes in RanGap1-KD cells. (C) PGC1-α, Drp1, PINK1 and TFAM were decreased, and Mfn1 and Parkin were increased in RanGap1-KD cells. (D) PGC1-α, Drp1, Mfn1, PINK1 and TFAM were increased in RanGap1-OE cells. (E) The cell viability was significantly decreased in RanGap1-OE cells under treating with 30 to 50 μM resveratrol compared to control cells. DMSO was used as negative control. The GAPDH was used as a loading control. The pooled data were shown here as the mean ± SEM, and the significant differences from control cells were shown in p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***). The independent experiments were repeated at least three times.

Figure 6. SIRT1 and RanGap1 have effects on Src/Erk/c-Fos pathway. Overexpression and knockdown of SIRT1 and RanGap1 were established in MCF-7 cells, and the protein levels were detected by Western blot. (A) RanGap1, Src and c-Fos were decreased in SIRT1-KD cells. (B) SIRT1, Src, p-Erk and c-Fos were decreased in RanGap1-KD cells. (C) SUMO1-RanGap1, Src and c-Fos were increased in SIRT1-OE cells. (D) SIRT1, Src, p-Erk and c-Fos were increased in RanGap1-OE cells. The GAPDH was used as a loading control. The pooled data were shown here as the mean ± SEM, and the significant differences from control cells were shown in p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***). The independent experiments were repeated at least three times.

Figure 6. SIRT1 and RanGap1 have effects on Src/Erk/c-Fos pathway. Overexpression and knockdown of SIRT1 and RanGap1 were established in MCF-7 cells, and the protein levels were detected by Western blot. (A) RanGap1, Src and c-Fos were decreased in SIRT1-KD cells. (B) SIRT1, Src, p-Erk and c-Fos were decreased in RanGap1-KD cells. (C) SUMO1-RanGap1, Src and c-Fos were increased in SIRT1-OE cells. (D) SIRT1, Src, p-Erk and c-Fos were increased in RanGap1-OE cells. The GAPDH was used as a loading control. The pooled data were shown here as the mean ± SEM, and the significant differences from control cells were shown in p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***). The independent experiments were repeated at least three times.

Table 1. Primers used for RT–PCR.

Table 1. Primers used for RT–PCR.

Accession NumbersGenesForwardReverseNM_001142498.2SIRT1TAGCCTTGTCAGATAAGGAAGGAACAGCTTCACAGTCAACTTTGTNM_002883.4RanGap1CACGCCCTCACGGAAGATTCCTGGGCTATCAGCACGGAGNM_001256799.3GAPDHACAACTTTGGTATCGTGGAAGGGCCATCACGCCACAGTTTCNM_198395.2G3BP1CGGGCGGGAATTTGTGAGATCTGTCCGTAGACTGCATCTGNM_003969.4UBE2MGGAAGCCAGTCCTTACGATAAACCGTTCTGCTCAAACAGCCGNM_002300.8LDHBCCTCAGATCGTCAAGTACAGTCCATCACGCGGTGTTTGGGTAATNM_006325.5RANTCTGGCTTGCTAGGAAGCTCAGCTGGGTCCATGACAACTTCTNM_030752.3TCP1CCAGCCACGCTATCCAGTCTCAAGGCAAGCAATTTTTGCATNM_004104.5FASNAAGGACCTGTCTAGGTTTGATGCTGGCTTCATAGGTGACTTCCANM_005573.4LMNB1GAAAAAGACAACTCTCGTCGCAGTAAGCACTGATTCCATGTCCANM_001618.4PARP1TCTGAGCTTCGGTGGGATGATTGGCATACTCTGCTGCAAAGNM_003540.4HIST1H4FAACGCATTTCGGGCCTCATTGCGCGTAGACAACATCCATTG