Selection and screening of spike protein-binding DARPin molecules

An in-house N3C DARPin library with >109 diversity was used in the phage panning essentially as described previously40. Purified full-length spike protein (BEI NR-52724) and RBD (BEI NR-52306) were biotinylated via EZ-link-sulfo-NHS-LC-biotin (Thermo Fisher Scientific, 21335) and used as target proteins. RBD was used as the target protein in Rounds 1, 2 and 4, while the full-length spike protein was used as the target in Round 3 to ensure the enrichment of DARPins that recognize RBD present on the full-length spike protein. Round 1 used the target protein (100 nM) in solution, whereas Rounds 2–4 employed decreasing concentrations of the target protein immobilized on streptavidin or neutravidin-coated ELISA plates (100, 50 and 20 nM). The enrichment of RBD binding DARPins was confirmed by phage ELISA against both RBD and full-length spike protein following a published protocol40 (Supplementary Fig. 1).

The enriched DARPin pool from the fourth round was cloned into the pET28a vector for high-level DARPin expression as described previously41. The resulting DARPin contains a Myc tag and a 6xHis tag at the N-terminus. After transformation, a total of 300 individual E. coli BL21 (DE3) clones were picked and grown in deep 96-well plates (1 ml per well) at 37 °C in Lysogeny broth (LB) and induced with isopropyl-β-d-thiogalactopyranoside (IPTG; 0.5 mM). The next day cell pellets were collected, resuspended in 200 μl of PBS (1.8 mM KH2PO4, 10 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4) and supplemented with lysozyme (200 μg ml−1; Amresco 0663-5G)41. An ELISA was used to identify the target binding DARPins. Briefly, Nunc MaxiSorp plates (Thermo Fisher Scientific, 50-712-278) were coated with 4 μg ml−1 neutravidin (Thermo Fisher Scientific, 31000) in PBS at room temperature for 2 h. The wells were washed with PBS and then blocked with PBS supplemented with 0.5% BSA (Thermo Fisher Scientific, BP9706100; PBS-B) at 4 °C overnight. The next day, after washing with PBS-T (PBS with 0.1% Tween 20), the wells were incubated with biotinylated RBD or full-length spike protein (20 nM in PBS) at room temperature for 1 h. The wells were washed again with PBS-T before the addition of 100 μl of cell lysate (fivefold diluted in PBS) and incubated at room temperature for 2 h. The amount of plate-bound DARPin in each well was quantified using mouse anti-myc antibody (Invitrogen, 13-2500, 1:2500 diluted in PBS-B) and HRP-conjugated goat antimouse antibody (Jackson ImmunoResearch, 115-035-146; 1:1000 diluted in PBS-B) as the primary and secondary antibodies, respectively, and BioFx TMB (VWR, 100359-154) for color development. In total, 20 and 23 clones showed significant ability to bind to RBD and full-length spike protein, respectively. Sequencing revealed 11 unique clones with significant ability to bind both RBD and full-length spike protein.

To identify DARPin clones able to block spike protein and hACE2 interaction, a competitive ELISA was used42. Briefly, the Maxisorp plates were first coated with full-length spike protein (BEI 52308, 2 nM in PBS) at room temperature for 2 h. The wells were blocked with PBS-B at 4 °C overnight, washed with PBS-T, and then incubated with mixtures of hACE2-HRP (prepared in-house, 0.5 nM) and different IMAC-purified DARPins (50 mM)41,43 at room temperature for 1 h. The amount of hACE2-HRP in each well was quantified using BioFx TMB.

For preparation of hACE2-HRP, hACE2 (Raybiotech, 230-30165; 1.76 mg ml−1) was first biotinylated as described above and then incubated with an equal molar amount of streptavidin-HRP (JIR, 016-030-084) in PBS at room temperature for 20 min and stored at −20 °C in 50% glycerol until use.

Plasmids

Plasmids encoding the wild type Δ19 spike protein were obtained from Addgene (145780). The plasmids for the Δ19 spike protein of B.1.617.2 and C.37 were generously provided by Nathaniel Landau (New York University)44. DNA fragment encoding the Δ19 spike protein of strain B. 1.351 and the RBD (residues 339-501) of B.1.1.529 was synthesized by Gene Universal and inserted into the pCG1 plasmid45. Paul Bieniasz (The Rockefeller University) provided the 293T cell clone 22 (293T.c22) with high expression efficiency of human ACE2 and the lentiviral reporter plasmid pHIV-1NL4-3-ΔEnv-NanoLuc46. The plasmid encoding the chimeric B.1.1.529 spike protein (B.1.1.529*) was constructed by replacing the RBD region (residues 338–514) in B.1.351 with that from B.1.1.529. Briefly, the gBlock fragment of B.1.1.529 RBD was digested with BsaI and BlpI, and ligated to (1) pCG1-B.1.351 backbone digested with BamHI and BlpI and (2) PCR product amplified from the same backbone with primers Spike_F and Spike_R and digested with BamHI and BsaI in a three-fragment-ligation reaction.

gBlock of B.1.1.529 RBD:

Aaaaaaggtctcacttcgatgaggtgttcaatgccaccagattcgcctctgtgtacgcctggaaccggaagcggatcagcaattgcgtggccgactactccgtgctgtacaacctggcccctttcttcaccttcaagtgctacggcgtgtcccctaccaagctgaacgacctgtgcttcacaaacgtgtacgccgacagcttcgtgatccggggagatgaagtgcggcagattgcccctggacagacaggcaacatcgccgactacaactacaagctgcccgacgacttcaccggctgtgtgattgcctggaacagcaacaagctggactccaaagtctctggcaactacaattacctgtaccggctgttccggaagtccaatctgaagcccttcgagcgggacatctccaccgagatctatcaggccggcaataagccttgtaacggcgtggccggcttcaactgctacttcccactgagatcctactcctttagacccacatatggcgtgggccaccagccctacagagtggtggtgctgagcttcgaa

Spike_F: cgaattcggatccgccacca (Italic letters denote BamHI recognition sequence)

Spike_R: ttttttggtctctgaaggggcacagattggtga (Italic letters denote BsaI recognition sequence)

To construct trimeric DARPin molecules, the DNA fragment encoding a codon-optimized T4 foldon (Protein Data Bank (PDB): 1RFO) was synthesized by Gene Universal (Newark, DE). T4 foldon was fused to the N-terminus of a DARPin molecule via a flexible (GGGGSLQ)x2 linker and cloned into the pET28a expression vector. DARPin SR16, SR22, FSR16 and FSR22 contain a 6xHis tag and a Myc tag at the N terminus, while SR16m and FSR16m contains only a 6xHis tag at the C terminus (Supplementary Fig. 3).

SARS-CoV-2 spike lentiviral pseudoviruses

Lentiviral pseudoviruses with different SARS-CoV-2 spike proteins (CoV2pp) were produced as previously reported46. Briefly, plasmids encoding the Δ19 spike protein and reporter pHIV-1NL4-3-ΔEnv-NanoLuc46 (1:3 molar ratio, 10 μg total) were mixed with 500 μl of serum-free DMEM medium and 44 μl of PEI (1 mg ml−1; Polysciences transporter 5, 26008-5) and used to transfect 5 × 106 293T cells seeded the night before. Twenty-four-hour post-transfection, the medium was replaced with fresh DMEM supplemented with 10% FBS and 48-h post-transfection the viral supernatant was collected, aliquoted and stored at −80 °C until use.

To determine the neutralization efficiency, serially diluted DARPin molecules were incubated with CoV2pp (final 500-fold diluted) at 37 °C for 30 min before being added to 293T.c22 cells seeded the night before at 104 cells per well in 96-well plates. The plates were incubated at 37 °C/5% CO2 for 48 h, and the NanoLuc signal from each well was quantified using the Nano-Glo Luciferase Assay kit (Promega, N1120) and a Cytation 5 plate reader equipped with Gen5 3.05 software.

DARPin protein production and characterization

All DARPin molecules were expressed in E. coli Bl21 (DE3) cells in LB medium supplemented with 50 μg ml−1 of kanamycin. Protein expression was induced with IPTG (0.5 mM) when the culture reached OD600 = 0.5. The protein expression was continued at 37 °C for 5 h, and the cells were collected by centrifugation. The proteins were purified via immobilized metal affinity chromatography (IMAC) using gravity Ni-NTA agarose columns. Protein purity was determined using 12% SDS–PAGE gels.

For in vivo studies, the IMAC-purified FSR16m was sterilized by filtration through a 0.22 μm filter, concentrated and buffer exchanged into PBS via ultrafiltration (Amicon column MWCO 10 KDa, UFC801024) before endotoxin removal using High-Capacity Endotoxin Removal Spin Columns (Pierce, 88274). The endotoxin level in the protein sample (1.5 mg ml−1) was quantified to be <30 U ml−1 using the Pierce Chromogenic Endotoxin Quant Kit (Thermo Fisher Scientific, A39552).

For size exclusion chromatography studies, DARPin samples (0.9 mg ml−1 × 0.25 ml) were loaded onto an Enrich SEC 70 × 300 Column equilibrated with PBS (GE AKTApure, with Unicorn 6.3 software). Vitamin B12 (Sigma, V2876-100MG) was used at a final concentration of 1 mg ml−1 as an internal control.

Spike RBD and DARPin avidity measurement

The human IgG1 Fc-tagged RBD proteins were made in-house as previously described33,47. The avidity measurement was performed on the ForteBio Octet RED 96 system (Sartorius). Briefly, the RBD proteins (20 µg ml−1) were captured onto protein A biosensors for 300 s. The loaded biosensors were then dipped into the kinetics buffer for 10 s for adjustment of baselines. Subsequently, the biosensors were dipped into serially diluted (from 0.13 to 300 nM) DARPin proteins for 200 s to record association kinetics and then dipped into kinetics buffer for 400 s to record dissociation kinetics. Kinetic buffer without DARPin was used to correct the background. Octet Data Acquisition 9.0 software was used to collect affinity data. For fitting of KD values, Octet Data Analysis software v11.1 was used to fit the curve by a 1:1 binding model using the global fitting method.

ELISA binding assay

ELISA plates were coated with recombinant DARPin protein (2 μg ml−1) at 4 °C overnight and blocked with 5% skim milk at 37 °C for 2 h. One hundred microliters of serially diluted human IgG1 Fc-tagged RBD proteins in 1% skim milk was added to each well, and the plates were incubated at room temperature for 3 h before the addition of 100 μl per well of HRP-conjugated goat anti-human IgG antibody (Jackson ImmunoResearch, 109-035-088; diluted 1:5,000), and the plates were incubated at room temperature for another hour. The plates were washed three to five times with PBS-T (0.05%, Tween 20) between incubation steps. TMB (3,3′,5,5′-tetramethylbenzidine) substrate was added at 100 μl per well for color development. The reaction was stopped by adding 50 μl per well 2 M H2SO4. The OD450 nm was read by a SpectraMax microplate reader using Softmax Pro 6.5.1 and analyzed with GraphPad Prism 8.

Cells and authentic viruses

Vero-TMPRSS2 (ref. 48) and Vero-hACE2-TMPRSS2 (ref. 49) (a gift of A. Creanga and B. Graham, NIH) were cultured at 37 °C in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% FBS, 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1× nonessential amino acids, 100 U ml−1 of penicillin–streptomycin and 5 μg ml−1 of puromycin. The B.1.617.2, B.1.617.2.AY1, B.1.351, BA.1, BA.1.1 and BA.2 SARS-CoV-2 strains were obtained from infected individuals and have been described previously15,50. Infectious stocks were propagated by inoculating Vero-hACE2-TMPRSS2 cells. Supernatant was collected, aliquoted and stored at −80 °C. All work with infectious SARS-CoV-2 was performed in Institutional Biosafety Committee-approved BSL3 and A-BSL3 facilities at Washington University School of Medicine using positive pressure air respirators and protective equipment. All virus stocks were deep-sequenced after RNA extraction to confirm the presence of the anticipated substitutions.

Mouse experiments

Animal studies were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381-01). Virus inoculations were performed under anesthesia that was induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering.

Heterozygous K18-hACE C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory. Animals were housed in groups and fed standard chow diets. Eight-week-old female mice were administered 103 FFU of SARS-CoV-2 via intranasal administration.

Measurement of viral burden

Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1,000 μl of DMEM media supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000g for 5 min and stored at −80 °C. RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Fisher Scientific) on a Kingfisher Flex extraction robot (Thermo Fisher Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (Thermo Fisher Scientific). Reverse transcription was carried out at 48 °C for 15 min followed by 2 min at 95 °C. Amplification was accomplished over 50 cycles as follows: 95 °C for 15 s and 60 °C for 1 min. Copies of SARS-CoV-2 N gene RNA in samples were determined using a previously published assay11,51. Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (forward primer, 5′-ATGCTGCAATCGTGCTACAA-3′; reverse primer, 5′-GACTGCCGCCTCTGCTC-3′; probe, 5′-/56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/-3′). This region was included in an RNA standard to allow for copy number determination down to 10 copies per reaction. The reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively.

Cytokine and chemokine protein measurements

Lung homogenates were incubated with Triton-X-100 (1% final concentration) for 1 h at room temperature to inactivate SARS-CoV-2. Homogenates were analyzed for cytokines and chemokines by Eve Technologies Corporation using their Mouse Cytokine Array/Chemokine Array 31-Plex (MD31) platform.

Authentic virus neutralization assay

Serial dilutions of DARPins were incubated with 102 FFU of the indicated SARS-CoV-2 strains for 1 h at 37 °C. DARPin-virus complexes were added to Vero-hACE2-TMPRSS2 cell monolayers in 96-well plates and incubated at 37 °C for 1 h. Subsequently, cells were overlaid with 1% (wt/vol) methylcellulose in MEM supplemented with 2% FBS. Plates were collected 24 h later by removing overlays and fixed with 4% PFA in PBS for 20 min at room temperature. Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57 and SARS2-71 antispike protein antibodies52 and HRP-conjugated goat antimouse IgG in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin. SARS-CoV-2-infected cell foci were visualized using TrueBlue peroxidase substrate (KPL) and quantitated on an ImmunoSpot microanalyzer (Cellular Technologies). Data were processed using Prism software (GraphPad Prism 8.0).

Cryo-EM sample and grid preparation

SARS-CoV-2 S6P spike protein was produced in 293F cells and purified from cell culture supernatant using a Ni-NTA agarose column followed by Superdex S200 16/600 (GE Healthcare) size-exclusion column chromatography as described53.

The subdomain SARS-CoV-2 RBD protein used in Cryo-EM was produced as previously described54 with minor modification. Briefly, the DNA sequence encoding RBD residues 330–526 was cloned in a mammalian expression vector with an HRV3C cleavable single-chain Fc tag before the coding sequence. The tagged RBD protein was expressed by transient transfection in FreeStyle 293 for 6 d. The desired protein in culture supernatant was captured by protein A resin and liberated by HRV3C cleavage. Finally, the subdomain RBD protein was purified on a Superdex 200 16/600 gel filtration column equilibrated with PBS.

The S309 IgG32 was expressed by transient transfection in Expi293F cells for 5 d at 37 °C and purified with Protein A Sepharose Fast Flow resin (Cytiva). The DNA encoding CR3022 IgG55 was cloned into a pVRC8400 vector with the addition of the HRV3C protease-cleavage site in the hinge region of IgG1 and expressed by transient transfection in Expi293F cells for 5 d at 37 °C and purified with protein A resin. The S309 Fab was cleaved from the S309 IgG using endoproteinase LysC (New England Biolab), and the CR3022 Fab was cleaved from CR3022 IgG with altered hinge with HRV3C protease. Protein A resin was then added to each mixture to remove Fc, and Fab was collected in the flowthrough and further purified on a Superose 6 10/300 SEC column (Cytiva) with X1 PBS (Gibco).

To generate SARS-CoV-2 S6P and FSR16m (or FSR22) complexes, SARS-CoV-2 S6P and FSR16m (or FSR22) were incubated in 1:3 molar ratio and the complexes were purified by Superdex S200 GL 10/300 (GE Healthcare) using 10 mM HEPES, 7.4, 150 mM NaCl as running buffer and were confirmed by SDS–PAGE and negative stain EM. To make RBD:SR22:S309Fab:CR3022Fab and RBD:SR16m:S309Fab:CR3022Fab ternary complexes, we incubated RBD (330–526) with molar excess of either SR22, C309 Fab and CR3022 Fab, or SR16m, S309 Fab and CR3022 Fab. 2.7 µl of the complexes at 1 mg ml−1 concentration in 10 mM HEPES, 7.4, 150 mM NaCl were deposited on Quantifoil R2/2 grids (quantifoil.com). Grids were vitrified using an FEI Vitrobot Mark IV (Thermo Fisher Scientific) with a wait time of 30 s, blot times of 1.5–4.5 s and blot force of 1.

Cryo-EM data collection and processing

The FSR22/SARS-CoV-2 S 6P and FSR16m/SARS-CoV-2 S 6P complexes grids were imaged using a Titan Krios electron microscope equipped with a Gatan K3 Summit direct detection device. Movies were collected at ×105,000 magnification over a defocus range of −1.0 to −2.25 µm for 2.3 s with the total dose of 40.02 e–/Å2 fractionated over 40 raw frames. Single particle cryo-EM data were collected with Latitude S. All data processing was done with cryoSPARCv3.3.1 (ref. 56). Motion correction and CTF estimation in patch mode, blob particle picking and particle extraction with the box size of 500 Å for the FSR22 (or FSR16m) : SARS-CoV-2 spike complexes and 230 Å for the RBD:SR22 (or SR16m):S309 Fab: CR3022 Fab complexes were performed followed by 2D classifications, ab initio 3D reconstruction, and multiple rounds of 3D heterogeneous refinement. C3 symmetry was applied for the final reconstruction of the FSR22/FSR16m: SARS-CoV-2 spike complex after the initial 3D heterogeneous refinement using C1 symmetry identified a trimer with three RBD-up conformation bound three SR22 (or SR16m) molecules. To define RBD–FSR22 interface (Supplementary Figs. 12 and 13), local refinement was performed using a soft mask covering one SR22 and one RBD molecule. The parameters for data collection and processing were summarized in Supplementary Table 2.

Model building and refinement

Coordinates from PDB 7BNO and the initial models of SR22/SR16m generated using AlphaFold were used for the initial fit to the reconstructed maps. To build S309 Fab and CR3022 Fab, PDB 7TN0 and 6YLA were used, respectively. Then, the models were manually built using Coot.v0.9.8.1 (ref. 57) followed by simulated annealing and real space refinement in Phenix v1.20.1-4487 (ref. 58) iteratively. Geometry and map fitting were evaluated throughout the process using Molprobity59 and EMRinger v1.0.0 (ref. 60). Figures were generated using PyMOL v2.4.2 (www.pymol.org) and UCSF ChimeraX.v1.3.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.