THP-1 cell culture

The human THP-1 monocytic cell line was obtained from ATCC (Manassas, VA, USA) and grown in a humidified incubator containing 5% CO2 and 95% air at 37 °C in RPMI 1640 medium (Gibco, Waltham, MA, USA) supplemented with 10% foetal bovine serum (FBS, Gibco, Waltham, MA, USA) and streptomycin (100 μg/ml)/penicillin (100 U/ml). To differentiate THP-1 monocytes into macrophages the cells were placed in 6-well plates (1.5 × 106 cells per well) in 3 ml of culture medium and treated with 100 nM phorbol 12-myristate 13-acetate (PMA, Sigma Aldrich, St. Louis, MO, USA) for 48 hrs [52]. After 3 days of rest THP-1 macrophages were polarized for 48 h with 10 ng/ml LPS (Salmonella Minnesota; InvivoGen, San Diego, CA, USA) or 20 ng/ml IL-4 (R&D Systems, Minneapolis, MN, USA) to M1 and M2 macrophages, respectively [53]. The control wells were subjected to the same environmental conditions as the stimulated wells. The pan-PAD inhibitor – BB-Cl-amidine (100 nM) was added 30 min before stimulation with LPS or IL-4. The toxicity of BB-Cl-amidine was evaluated by MTT assays at 48 h.

MTT metabolism assay

To assess THP-1-cell viability after 48 h of BB-Cl-amidine treatment, cells were seeded in a 96-well plate at a density of 50,000 cells per well. Then, 10 μL of a 10 mg/ml MTT solution was added to each well and incubated at 37 °C for 1 hour. Next, the medium was aspirated, 200 uL of DMSO was added, and the plate was shaken for 1 h to dissolve the dye. The absorbance was measured at 570 nm using a Synergy™ 2 microplate reader (BioTek Instruments Inc., Winooski, VT, USA).

Silencing PAD2

To knockdown PAD2 in THP-1 macrophages, Lipofectamine® RNAiMAX reagent and 25 pmol Silencer®Select PADI2 siRNA (assay ID: s223214)(Thermo Fisher Scientific, Waltham, MA, USA) were used according to the manufacturer’s instructions. Silencer®Select Negative Control #2 (assay ID: 4390846) (Thermo Fisher Scientific, Waltham, MA, USA) was used as the scrambled siRNA negative control. Transfection was performed on Day 2 in resting macrophages for 24 h in RPMI 1640 medium without FBS and antibiotics in 6-well plates.

After stimulation, the cell supernatant was collected, passed through 0.22 μm filters and frozen. THP-1 macrophages were lysed in lysis buffer for further experiments.

Quantitative reverse transcription polymerase chain reaction

Activation of THP-1 macrophages to the M1 and M2 phenotypes was determined by real-time PCR. The expression levels of proinflammatory genes (IL-1β, IL-6, TNF-α), anti-inflammatory genes (mannose receptor C-type 1 (MRC1), Fc epsilon receptor II (FCER2), arachidonate 15-lipoxygenase (ALOX15)) and PAD isoforms (PAD1, PAD2, PAD3, PAD4) in THP-1 macrophages were determined according to previously described protocol [54]. Briefly, RNA was isolated using the ReliaPrep™ RNA Cell Miniprep System (Promega, Madison, WI, USA) and transcribed to cDNA with the High Capacity cDNA Reverse Transcription Kit (Thermo Scientific, Waltham, MA, USA). Commercially available primers from Bio-Rad (Hercules, CA, USA) (apart from primers for PAD3: 5’CTGGATTGCGACCTGAACTG3’ (forward): 5′ TGTGGTCATCAAAGAGGGCT 3′ (reverse) and PAD4: 5′ ACTCTCCAAGGAACAGAGG 3′ (forward), 5′ GGTATTCCTTGCCCCTGACT 3′ (reverse)) and 2x SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA) were used for real-time PCR. Analysis of relative gene expression was performed by the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with GAPDH as an internal reference gene, and the data were analysed using the 2–∆∆Ct method in an Excel spreadsheet.

Enzyme-linked immunosorbent assay (ELISA)

The concentrations of proinflammatory cytokines (IL-1β, IL-6, TNF-α) in the supernatant of THP-1 macrophages were measured by a RayBio® Human IL-1 beta ELISA Kit, RayBio® Human IL-6 ELISA Kit and RayBio® Human TNF-alpha ELISA Kit (RayBiotech, Norcross, GA, USA) according to the manufacturer’s instructions.

Seahorse real-time cell metabolic analysis

Mitochondrial respiration in THP-1 macrophages activated to the M1 and M2 phenotypes in the presence of BB-Cl-amidine was measured as the oxygen consumption rate (OCR) using a Seahorse XF96 Metabolic Flux Analyser (Agilent Technologies, Santa Clara, CA, USA). THP-1 monocytes were differentiated into macrophages in Seahorse XF96 cell culture plates at a density of 40,000 cells per well. THP-1 macrophages were stimulated with 10 ng/ml LPS or 20 ng/ml IL-4 in the presence of 100 nM BB-Cl-amidine for 24 h. The Seahorse XF Cell Mito Stress Test was performed according to the manufacturer’s protocols. The medium was replaced with XF Base Medium (Agilent, Santa Clara, CA, USA) supplemented with 25 mM glucose, 1 mM sodium pyruvate, and 2 mM L-glutamine (pH 7.4) followed by incubation at 37 °C in a non-CO2 incubator for 1 hour. Oligomycin (1 μM), carbonyl cyanide phospho-(p)- trifluoromethoxy phenylhydrazone (FCCP) (1 μM), and rotenone/antimycin A (0.5 μM) were subsequently injected into the wells. At the end of the analysis, the medium was removed, and the cells were lysed in RIPA buffer. The protein concentration was measured by the Pierce™ BCA Protein Assay Kit (Thermo Scientific, Waltham, MA, USA) and used to normalize the OCR. The data were analysed with Wave (version 2.6.1) software (Agilent Technologies, Santa Clara, CA, USA).

Liquid chromatography–tandem MS (LC-MS/MS) analysis of THP-1 macrophages

THP-1 macrophages were lysed in a buffer containing 0.1 M Tris-HCl, pH 7.6, 2% sodium dodecyl sulfate, and 50 mM dithiothreitol (Sigma Aldrich, St. Louis, MO, USA) at 96 °C for 10 min. The protein concentration was determined by a Pierce 660 nm Protein Assay Kit (Thermo Scientific, Waltham, MA, USA). Seventy micrograms of protein was digested overnight using the filter-aided sample preparation (FASP) method [55, 56] with endoproteinase Lys-C (enzyme-to-protein ratio 1:35) as a digestion enzyme. Next, the samples were purified with C18 Ultra-Micro SpinColumns (Harvard Apparatus, Holliston, MA, USA). For macrophage spectral library preparation equal amounts of peptides from all samples were subjected to a high-pH fractionation protocol on C18 Micro SpinColumns (Harvard Apparatus, Holliston, MA). Fractionation was carried out in 50 mM ammonium formate buffer (pH 10) with 12 consecutive elution steps with 5, 10, 12.5, 15, 17.5, 20, 22.5, 25, 27.5, 30, 35 and 50% acetonitrile in 50 mM ammonium formate buffer (pH 10). All samples and library fractions were dissolved in 0.1% formic acid and 5% acetonitrile at a concentration of 0.5 μg/μl and spiked with the iRT peptides (Biognosys, Schlieren, Switzerland).

One microgram of peptide was injected into a PepMap100 RP C18 75 μm i.d. × 25 cm column (Thermo Scientific, Waltham, MA, USA) via a PepMap100 RP C18 75 μm i.d. × 2 cm trap column (Thermo Scientific, Waltham, MA, USA) and separated using a 1 to 40% B phase linear gradient (A phase - 2% ACN and 0.1% FA; B phase - 80% ACN and 0.1% FA) with a flow rate of 300 nL/min on an UltiMate 3000 HPLC system (Thermo Scientific, Waltham, MA, USA) coupled to a TripleTOF 6600+ (Sciex, Framingham, MA, USA) mass spectrometer. The nanoelectrospray ion source (Optiflow, Sciex, Framingham, MA, USA) parameters were as follows: ion spray voltage: 3.2 kV; interface heater temperature (IHT): 200 °C; ion source gas 1 (GS1): 10; and curtain gas (CUR): 25. For DDA acquisition, spectra were collected for 135 min in full scan mode (350–1400 Da), followed by one hundred CID MS/MS scans of one hundred of the most intense precursor ions from the preceding survey full scan exceeding 100 cps intensity under dynamic exclusion criteria. For DIA acquisition, spectra were collected for 100 min in full scan mode (400–1250 Da), followed by one hundred SWATH MS/MS scans using a variable precursor isolation window approach, with m/z windows ranging from 6 to 90 Da.

DDA-MS data were searched against the human UniProt database and MaxQuant Contaminants list using the Pulsar search engine in Spectronaut software (Biognosys, Schlieren, Switzerland) [57] with the following parameters: ± 40 ppm mass tolerance on MS1 and MS2 levels, mutated decoy generation method, Lys-C enzyme specificity, 1% protein and PSM false discovery rate (FDR). The library was generated using 3–6 fragment ions per precursor. The generated human macrophage library was used to analyse DIA-MS data in Spectronaut software. MS data were filtered by 1% FDR at the peptide and protein levels, while quantitation and interference correction were performed at the MS2 level. The data were normalized by a global regression strategy, Q-value percentile data filtering was set at 50%, and global imputation for missing values was performed. Statistical analysis of differential protein abundance was performed at both the MS1 and MS2 levels [58] using unpaired t-tests with multiple testing correction after Storey [59].

Constructing protein-protein interaction (PPI) networks

Functional groupings and pathway analysis were performed using PINE (Protein Interaction Network Extractor) software [60] with the STRING and GeneMANIA databases, a score confidence (0.4) and ClueGO p value cut-off < 0.05. The mass spectrometry data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository [61] with the dataset identifier PXD034591.

Mapping citrullination sites using a hypercitrullinated library approach

To prepare a hypercitrullinated library, THP-1 macrophages were lysed as described previously. Each sample (200 μg) was divided into two tubes (twin samples). To digest proteins and preserve citrullination residues, the FASP method with Lys-C as the digestion enzyme was used. The deimidation reaction was performed on Microcon-30 centrifugal filters during the FASP protocol as described previously [62]. Briefly, one twin sample was treated with the PAD cocktail (cocktail of the five PAD isoforms PAD1, PAD2, PAD3, PAD4, and PAD6; 1:20 ratio, (SignalChem, Richmond, Canada)), while the second sample was treated with H2O at the same ratio. All samples were incubated in deimination buffer (100 mM Tris-HCl (pH 8.5), 5 mM CaCl2, 0.5 mM DTT) for 2 h at 37 °C. Then, digestion with Lys-C was carried out overnight at 37 °C, and the samples were cleaned on an Oasis HLB plate (Waters, Milford, MA, USA) prior to LC − MS analysis. To fractionate the desalted samples, a Pierce™ High pH Reversed-Phase Peptide Fractionation Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used according to the manufacturer’s instructions with the following modifications: each sample was fractionated into 5 fractions with 7.5, 10, 12.5, 15 and 17.5% ACN in the elution solution. LC-MS analysis was performed as described previously.

A hypercitrullinated library was prepared using SpectraST v.4.0 as described previously [63]. Briefly, all data were searched using X!Tandem Native v.2013.06.15.1, X!Tandem Kscore v.2013.06.15.1, and Comet v.2014.02 rev.2. The search parameters included the following criteria: static modifications of carbamidomethyl (C) and variable modifications of oxidation (M), deamidation (NQ), and citrullination (R). The parent mass tolerance was set at 50 ppm, and the monoisotopic fragment mass tolerance was 100 ppm (which was further filtered to be < 0.05 Da to build the spectral library); LysC peptides with up to two missed cleavages were allowed. The identified peptides were processed and analysed by Trans-Proteomic Pipeline v.4.8 and were validated using PeptideProphet scoring, and the PeptideProphet results were statistically refined using iProphet. All peptides were filtered at an FDR of 1% with a peptide probability cut-off of ≥0.99. To identify citrullinated peptides from DIA runs, a hypercitrullinated spectral library generated by SpectraST was used with CitFinder software to analyse modified-unmodified peptide pairs for physicochemical properties such as ΔRT shift, charge state and neutral loss [63]. Statistical analysis of citrullinated peptides was performed in Perseus [64]. Citrullinated peptide quantities were normalized to their corresponding protein levels. For quantitative analysis, only citrullinated peptides present in at least 50% of each biological group were chosen. Missing values were imputed using a row average imputation method. ANOVA with post- hoc tests and permutation-based FDR correction were used for the statistical analysis of data in Perseus.

Statistical analysis

Variables are expressed as the mean ± SEM. The equality of variance and normality of the data were checked by the Brown-Forsythe test and Shapiro-Wilk test, respectively. Based on the results, statistical analysis was performed using either t test (two groups), ordinary one-way ANOVA, Brown-Forsythe and Welch ANOVA or Kruskal-Wallis tests with correction for multiple comparisons by controlling the False Discovery Rate (two-stage linear step-up procedure of Benjamini, Krieger and Yekutieli) (Graphpad Prism 9.3.1, San Diego, CA, USA). Two-way ANOVA was used for the OCR analysis. Values of p < 0.05 (or q-values for proteomics experiments) were considered statistically significant.