Cell culture

Human ESC cell line SEES4 (donated by RIKEN BRC. Japan) was cultured and maintained using StemFit (AK02N, Ajinomoto). Before reaching subconfluency, the cells were dissociated with TrypLE Select (Thermo Fisher)/0.25 mM EDTA and suspended in StemFit containing 10 µM Y-27632. The cells (1 × 104) were then suspended in StemFit containing 10 µM Y27632 and 8 µl iMatrix511 (human laminin-511 E8 fragment, Nippi) and added to a 6 cm dish. Next day, the culture media were replaced with fresh StemFit without Y-27632. After that, the media were replaced every two days until the next passage (Table 1).

Table 1 Oligos for PX459-MKX gRNAEstablishment of an MKX-tdTomato reporter cell line

Figure 1A depicts the targeting strategy for the knock-in of the IRRS-tdTomato-PGK-Neo cassette at the MKX 3’ untranslated region (UTR) to achieve MKX and tdTomato coexpression. To construct the targeting vector (pEXA2J2-hMKX HA-IRES-tdTomato-PGK-Neo), primers listed in Table 2. were used and IRES-tdTomato-PGK-Neo fragments were inserted into the pEXA2J2-hMKX homology arm (pEXA2J2-hMKX HA; artificially synthesized by Eurofins) using an In-Fusion HD cloning kit (Takara).

Fig. 1

Establishment of a MKX-tdTomato reporter hPSC line. a The targeting cassette of the MKX-tdTomato knock-in allele. PAM sequence (CCA) is highlighted in red. b Generation of the MKX-tdTomato reporter hPSC line. The targeting and gRNA-Cas9 expression vector were electroporated into the hESC line SEES4. After selection with G418, single colonies were selected, expanded, and screened to identify the integration of the knock-in reporter cassette. c. Agarose gel electrophoresis of PCR products using forward and reverse primers that recognize sequences outside the targeting cassette. Genomic DNAs were purified from SEES4 wild type and MKX-tdTomato reporter hPSCs. WT, wild type allele; KI, knock-in allele. Full-length blot is presented in Additional file 1: Fig. S1

Table 2 Oligos for pEXA2J2-3´MKX HA-IRES-tdTomato-PGK-Neo

Guide RNAs (gRNA) were designed to target the protospacer adjacent motif (PAM) sequence-located MKX locus (CCAACGCCATATGCTTATTAGCC; the PAM sequence is indicated in bold font). The number of potential target sites in the human genome are 1 site (20 mer + PAM), 1 site (12 mer + PAM) and 389 sites (8 mer + PAM). gRNA oligos (Table 1) were designed and subcloned into the PX459 vector (Addgene, #62988) harboring a Cas9 expression cassette (PX459-MKX gRNA). To generate the MKX-tdTomato reporter line, 1 × 106 SEES4 hESCs were electroporated with pEXA2J2-hMKX HA-IRES-tdTomato-PGK-Neo (1 µg) and PX459-MKX gRNA (10 µg). Selection with G418 (Life Technologies) was performed until stable colonies appeared; then, colonies were selected for expansion. To verify the precise integration of IRES-tdTomato-PGK-Neo cassette into the MKX 3’ UTR, genomic DNA was amplified using the primers in the 5’ and 3’ direction for PCR genotyping. The primers used are listed in Table 3.

Table 3 Genotyping primers for MKX-tdTomato reporterTenogenic differentiation of hPSCs

The hPSCs suspension (3 × 104 cells in 1 ml of StemFit (Ajinomoto) containing 10 µM Y27632 (Wako), and 4 µl of iMatrix511 (1:250 dilution)) was seeded onto a 3.5-cm culture dish. The culture medium was replaced the next day with fresh StemFit without Y-27632. After culturing for 2 days, the cells were washed with PBS, and differentiation was induced by changing the culture medium at each time point. A chemically defined CDM2 medium was used as the basal culture medium supplemented with cytokines and chemicals to prepare each differentiation medium. The composition of the CDM2 basal medium was as follows: 50% IMDM (+ GlutaMAX; Gibco), 50% F12 (+ GlutaMAX; Gibco), 1 mg/ml polyvinyl alcohol (Sigma-Aldrich), 1% (vol/vol) chemically defined lipid concentrate (Gibco), 450 μM monothioglycerol (Sigma-Aldrich), 7 µg/ml insulin (Sigma-Aldrich), 15 μg/ml transferrin (Sigma-Aldrich), and 1% (vol/vol) penicillin–streptomycin (Gibco). On day 0, hPSCs were differentiated into the anterior primitive streak in the CDM2 medium supplemented with 30 ng/ml Activin A (R&D), 4 μM CHIR99021 (GSK3β inhibitor; Axon Medchem), 20 ng/ml FGF2 (Wako), 100 nM PIK90 (PI3K inhibitor; Millipore), and 10 μM Y-27632 for 24 h. For paraxial mesoderm (PM) differentiation, CDM2 medium containing 1 μM A-83-01 (ALK4/5/7 inhibitor; Tocris), 3 μM CHIR99021, 250 nM LDN-193189 (ALK2/3 inhibitor; ReproCELL), 20 ng/ml FGF2, and 10-μM Y-27632 was added for 24 h. On day 2, cells were cultured in a differentiation medium supplemented with 1 μM A-83-01, 250 nM LDN-193189, 1 μM C59 (PORCN inhibitor; Cellagen Technology), 500 nM PD0325901 (MEK inhibitor; Tocris), and 10 μM Y-27632 for 24 h. On day 3, somite cells were differentiated into sclerotome (SCL) cells after two days of culture in a CDM2 medium containing 5 nM SAG 21 K (SMO agonist, R&D), 1 μM C59, and 10 μM Y-27632. Subsequently, for syndetome (SYN)/tenocytes induction, cells were cultivated in the CDM2 medium supplemented with 20 ng/ml FGF8 (BioLegend) and 10 μM Y-27632 for the first three days and in the CDM2 medium supplemented with 10 ng/ml TGF β 3 (BioLegend), 10 ng/ml BMP7 (BioLegend), and 10 μM Y-27632 for the next 18 days.

Immunocytochemistry

Cultured cells were washed with PBS, fixed with 4% paraformaldehyde (PFA) for 20 min at room temperature, and incubated with blocking solution (3% normal goat serum and 0.1% Triton X-100 in PBS) for 1 h at room temperature. Next, the cells were incubated with primary antibodies (1:200 dilution) at 4 ˚C overnight. The secondary antibodies (1:500 dilution) were subsequently added to the cells for 1 h at room temperature. After incubation, 0.1 µg/ml DAPI (Thermo Fisher) in PBS was used to counterstain the nuclei. The samples were then observed using a BZ-X710 fluorescence microscope (Keyence). The antibodies used are listed in Table 4.

Table 4 Antibodies used for immunocytochemistryRNA extraction and quantitative reverse transcription–polymerase chain reaction

RNA was extracted using an RNeasy kit (Qiagen), and complementary DNA was synthesized using M-MLV reverse transcriptase (Thermo Fisher) and random primers (Thermo Fisher). The expression of specific genes was analyzed by qPCR using an ArialMX real-time PCR system (Agilent). The cycle parameters include denaturation at 95 °C for 30 s, annealing at 62 °C for 30 s, and elongation at 72 ˚C for 30 s. The mRNA expression levels of each gene were normalized to β -Actin (ACTB) and quantified using the 2−∆∆Ct method. The primer sequences are listed in Table 5.

Flow cytometry

Dissociated cells were suspended in 100 μl of 2% FBS/PBS containing 10 ng/ml DAPI. Furthermore, tdTomato expression was detected and analyzed using a CytoFLEX S flow cytometer (Beckman Coulter) and FlowJo software (FlowJo LLC), respectively.