Reagents

Mouse TAFA4 ELISA kit was purchased from Kanglang Biotech (Shanghai, China). Anti-mouse FPR1 (PAB0284) Ab were purchased from Kemi Biotech (Shanghai, China). Anti-mouse TAFA4 Ab (PA569319) was purchased from Shanghai Saimofeishier Biotech (Shanghai, China). Recombinant mouse TAFA4 protein was purchased from CUSABio (Wuhan, China). MyD88 (sc-74532, E-11), AKT (sc-81434, 5C10; sc-514032, C-11), CD11c (sc-398708, D-8, AF594), IL-10 (sc-57245, 2G101H7, AF488), CD3 (sc-20047, PC3/188 A, AF488), CD4 (sc-19641, MT310, AF594), CD49b (sc-53353, HAS-4, AF546), LAG3 (sc-32750, C9B7W, AF648) were purchased from Santa Cruz Biotech (Santa Cruz Biotech (Santa Cruz, CA). Ki-67 Ab (ab16667, SP6, AF488) was purchased from abcam (Cambridge, MA). ELISA kits of sIgE, Mcpt1, EPX, IL-4, IL-5, IL-10, IL-13 were purchased from CRK Pharma (Wuhan, China). The ChIP kit was purchased from Sigma Aldrich (St. Louis., MO). Reagents and materials for RT-qPCR and Western blotting were purchased from Invitrogen (Carlsbad, CA).

Mice

C57/B6 mice were purchased from the Guangdong Provincial Experimental Animal Center (Guangzhou, China). By employing the genetic engineering approach, we constructed Fpr1f/fItgax-Cre mice (here we called Fpr1ΔDC mice), that deleted the Fpr1 gene in DCs, expressing Cre recombinase from the Itgax promoter (Itgax-Cre mice), were crossed with mice with loxP-flanked Fpr1 exons 1 and 2 (Fpr1f/f mice). To initiate the Fpr1 gene ablation, Fpr1ΔDC mice were gavage-fed with tamoxifen (200 mg/kg in corn oil) daily for 5 consecutive days before experiments. DCs in the airway tissues of Fpr1ΔDC mice did not show detectable Fpr1 expression. The frequency of DC in the airway tissues of Fpr1ΔDC mice was not significantly different between wild type (WT) mice and Fpr1ΔDC mice. In the same approach, mice carrying Il10rb-deficient CD4+ T cells (Il10rbf/fCd4-Cre mice; here we call Il10rbΔCd4tc mice, that deleted the Il10rb gene in CD4+ T cells, expressing Cre recombinase from the Cd4 promoter, the Cd4-Cre mice) were crossed with mice with loxP-flanked Il10rb exons 1 and 6 (Il10rbf/f mice). To initiate the Il10rb gene ablation, Il10rbΔCd4tc mice were gavage-fed with tamoxifen (200 mg/kg in corn oil) daily for 5 consecutive days before experiments. CD4+ T cells in the airway tissues of Il10rbΔCd4tc mice did not show detectable Il10rb expression. The frequency of DC in the airway tissues of Il10rbΔCd4tc mice was not significantly different between wild-type (WT) mice and Il10rbΔCd4tc mice. Cd4-Cre mice, Itgax-Cre mice and DO11.10 mice were purchased from Jackson Laboratory (Bar Harbor, ME). Mice were maintained in a specific pathogen-free facility with accessing water and food freely.

Enzyme-linked immunosorbent assay (ELISA)

Levels of cytokines and sIgE (OVA specific IgE) in the serum or NLF were determined by ELISA with commercial reagent kits following the manufacturer’s instruction.

Flow cytometry (FCM)

To stain molecules on the cell surface, cells were incubated with fluorescence-labeled Abs (detailed in figures) or isotype IgG (Abs were diluted into 1 µg/ml) for 30 min at 4 °C. After washing with PBS, cells were analyzed with a flow cytometer (BD FACSCanto II). To stain the intracellular molecules, cells were fixed with 1% paraformaldehyde (containing 0.05% Triton X-100) for 1 h. Cells were then processed with the procedures of surface staining. The data were processed with a software package (Flowjo, TreeStar Inc., Ashland, OR). The data obtained from isotype IgG staining were used as gating references.

Real-time RT-PCR (RT-qPCR)

RNA was extracted from cells obtained from relevant experiments. The RNA samples were converted to cDNA with a reverse transcription kit following the manufacturer’s instruction. The cDNA samples were then amplified in a qPCR device (Bio-Rad CFX96) with the SYBR Green Master Mix in the presence of primers of Ki67 (gccataacccgaaagagcag and ccagtttacgctttgcaggt), Il10 (ataactgcacccacttccca and gggcatcacttctaccaggt), Cd80 (ttatcatcctgggcctggtc and gtgtctgcagatgggtttcc), Cd83 (gctctcctatgcagtgtcct and actctgtagcttccttgggg), Cd86 (gcacgtctaagcaaggtcac and catatgccacacaccatccg), Ccr7 (gggctggtgatactgacgta and acacaggtagacgccaaaga), Fpr1 (tcagcactcccatgtccatt and tcacggacttggattgtgga), Cmip (cctacagcgccattgaagac and ggcttgggttactcaggact), Maf (gtcccctggccatggaatat and tagtagtcttccaggtgcgc). The results were calculated with the 2-∆∆Ct method, and presented as relative expression.

Western blotting

DCs were isolated from AMCs. Proteins were extracted from DCs, fractioned by SDS-PAGE, and transferred onto a PVDF membrane. After blocking with 5% skim milk for 30 min, the membrane was incubated with the primary Abs (detailed in figures; diluted to 200 ng/ml) for 2 h at room temperature, washed with TBST (Tris-buffered saline containing 0.05% Tween 20) 3 times, incubated with HRP-labeled secondary Abs (diluted to 20 ng/ml) for 2 h at room temperature, washed with TBST 3 times. Immunoblots on the membrane were developed with the enhanced chemiluminescence, and photographed in an imaging station.

Chromatin immunoprecipitation (ChIP)

DCs were prepared and fixed in 1% formalin for 15 min. The cells were lysed, and followed by sonication to shear the DNA into small pieces. Samples were precleared by incubating with protein G agarose beads for 2 h. The beads were removed by centrifugation. Supernatant was incubated with anti-c-Maf Ab for 2 h, and followed by incubating with protein G agarose beads for 2 h. Proteins on the beads were eluted; DNA was extracted from the samples with a DNA extracting reagent kit following the manufacturer’s instruction, and analyzed by qPCR in the presence of Il10 promoter primers (ctgtgccaacgaagatcctc and aacattcgcctagagtcccc). The results were presented as fold change against the input. The uncropped gel graphs are presented in supplemental materials.

RNA-sequencing (RNAseq)

DCs were isolated from AMCs. Total RNA was extracted from DCs using the TRIzol reagents. The RNA samples were analyzed by professional staff in a biotech company (BGI, Shenzhen, China). Briefly, the library was constructed first (RNA-Seq Library Prep Kit; Illumina), followed by analyzing with an Illumina platform (HiSeq 2500, Illumina, San Diego, CA). Gene expression was assessed using the DESeq R package (version 1.18.0). Multiple adjustment tests were performed to calculate the adjusted P-value (adjpval). Genes with corrected P values of less than 0.05 and log2 (fold change, FC) of 1 or greater between two groups were considered to have significantly differential expressions. The gene significantly differential expression between the two groups was determined when p < 0.05 and log2 (fold change, FC) of 1 or greater. The differentially expressed genes (DEGs) were analyzed by signaling pathway enrichment assay with the KEGG database, and further by ontology analysis. The raw gene data are presented in Table S1.

Human subjects

Patients (n = 30, male = 15, female = 15) with perennial allergic rhinitis (AR) were enrolled into the present study from May 2021 to May 2022 in our hospital. The using human samples in the present study was reviewed and approved by the Human Ethics Committee at our hospital (Approve number: SMUSZHE2021003). A written informed consent was obtained from each human subject. The diagnosis of AR and collection of nasal secretion were carried out by doctors of our hospital based on our routine procedures that can be found elsewhere29. AR patients had AR history at least for 2 years, serum specific IgE (sIgE) positive, skin prick test positive. Health control (HC) subjects (n = 30, male = 15, female = 15) were also enrolled into the present study. HC subjects did not have any appreciable diseases, serum sIgE negative and skin prick test negative.

Development of an AR mouse model

The Animal Experimental Protocol was reviewed and approved by the Animal Ethics Committee at Southern Medical University (Approve#: SMUAEC0222019). As depicted in Supplementary Fig. 1 (in supplemental materials), mice were sensitized by subcutaneous injection of ovalbumin (OVA, 100 µg/mouse, mixed in 0.1 ml Alum) in the back skin on day 1 and day 7, respectively. Mice were boosted by nasal instillation (20 µl/nostril, 5 mg/ml) daily from day 9 to day 22. On day 23, mice were challenged with the specific antigen (OVA) by nasal instillation (20 µl/nostril, 50 mg/ml).

Assessment of the AR response in mice

A clinical response of AR (nasal scratches and sneezes) was recorded in each mouse within a 30-minute period after the nasal antigen challenge. Under general anesthesia (60 mg/kg pentobarbital, ip), blood samples were taken from each mouse using the eyeball drawing method. After that, the trachea was exposed. With a syringe, 1 ml of saline was injected into the trachea (in the direction of the nose; the head was put in the lower position). The saline solution was taken from the nostrils with an Eppendorf tube and used as a nasal wash fluid (NLF) in other experiments.

Preparation of airway mononuclear cells (AMCs)

The nasal tissues and the lungs were excised from the mice on the sacrifice. The tissues were cut into small pieces, incubated with collagenase IV for 20 min at 37 °C with light shaking. Single cells were filtered through a cell strainer (70 µm first, then 40 µm). AMCs were further isolated from single cells with the Percoll gradient density centrifugation.

Immune cell isolation

DCs and CD4+ CD25¯ T cells were isolated from mouse spleen cells using commercial reagent kits (Miltenyi biotech) as per the manufacturer’s instructions. For Tr1 cell isolation, AMCs were labeled with Abs of CD3 (FITC), CD4 (AF594), LAG3 (AF546), CD49b (AF647). The Tr1 cells (CD3+ CD4+ LAG3+ CD49b+) were isolated from AMCs by FCM. The purified immune cells were checked by FCM. If purity did not reach or exceed 95%, purification would be repeated.

Assessment of immune suppressive function of Tr1 cells

Tr1 cells were isolated from AMCs of AR mice treated with the AIT or/and TAFA4 therapies. DCs and CD4+ CD25¯ T cells (Effector T cells or Teffs; labeled with CFSE) were isolated from the DO11.10 mouse spleen cells. Tr1 cell:DC:Teff cells were co-cultured at a ratio of 1:1:5 in the presence of OVA (1 µg/ml) or BSA (used as an irrelevant antigen, negative control) for 3 days. Cells were harvested on day 3, and analyzed by FCM, the CFSE-dilution assay. Teff proliferation was assessed and used as an indicator for Teff activities.

Statistics

The difference between two groups was determined by the two-tail Student’s t test. Multiple comparisons were carried out with ANOVA, then with the Dunnett test or the Bonferroni test for groups of more than two groups. p < 0.05 was set as a significant criterion.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.