Experimental animals (ethics statement): Leiden, LUMC (The Netherlands)

Animal experiments were granted with a license DEC12042 and 14207 by Competent Authority after an advice on the ethical evaluation by the Animal Experiments Committee Leiden and were performed in accordance with the Experiments on Animals Act (Wod, 2014), the applicable legislation in the Netherlands in accordance with the European guidelines (EU directive no. 2010/63/EU). Experiments were executed in a licensed establishment for experimental animals. Mice were housed in ventilated cages with autoclaved aspen woodchip, fun tunnel, wood chew block and nestlets (12:12 hour (h) light-dark cycle; 21 ± 2 °C; relative humidity of 55 ± 10%) and fed with a commercially-prepared autoclaved, dry rodent diet pellets and provided with water, both available ad libitum. Female OF1 and C57BL/6 mice (6–7 weeks; Charles River Laboratories, France) were used. Experiments involving generation of mutant parasite lines and phenotype analyses were performed using highly standardized and approved protocols that have been developed to reduce the number of animals and minimize suffering and distress. Mice were killed (cardiac puncture under isoflurane anesthesia or CO2) at a parasitemia of 2–5%, before malaria-associated symptoms occur. Humane endpoints: the animals/body condition was thoroughly examined daily. Animals are humanely sacrificed in case the following defined end points are reached: visible pain (abnormal posture and/or movement), abnormal behavior (isolation, abnormal reaction to stimuli, no food and water intake). If distress of the animals is observed by the animal caretakers, this will be reported to the investigators and according to the aforementioned criteria, the animals will be taken out of the experiment and euthanized. In all experiments no mice were euthanized before termination of the experiment and no mice died before meeting criteria for euthanasia.

Mosquitoes

Mosquitoes from a colony of Anopheles stephensi (line Nijmegen SDA500) were used. Larval stages were reared in water trays (at 28 ± 1 °C; relative humidity 80%). Adult females were transferred to incubators at 26 ± 0.2 °C (relative humidity of 80%) and were fed with 5% filter-sterilized glucose solution. For the transmission experiments, 3 to 5 day-old mosquitoes were used. Following infection, the P. berghei and P. falciparum, infected mosquitoes were maintained at 21 °C and 26 °C, respectively, at 80% relative humidity.

Parasites

For generation of the rodent malaria LA-GAP PbΔmei2, the P. berghei ANKA reference line 1868cl1 was used (line RMgm-1320; www.pberghei.eu) which contains the reporter genes mCherry and luciferase under control of the constitutive hsp70 and eef1α promoters, respectively, integrated into the neutral 230p gene locus (PBANKA_0306000). This line does not contain a drug-selectable marker. Production of PbΔmei2 and characterization of these parasites throughout their life cycle, including mosquito transmission, was performed under GMO permits IG 17-230_II-k en IG 17-135_III.

P. falciparum parasites NF54 strain35 was used as wild-type P. falciparum parasites (WT PfNF54). Parasites from the PfNF54 strain, and its derivative Pf3D7, are the most commonly used P. falciparum parasites in laboratory studies and in Controlled Human Malaria infections (CHMI;36). The complete genome sequences of Pf3D7 and PfNF54 have been published37,38. The parasites of PfNF54 and Pf3D7 have been deposited with the Malaria Research and Reference Reagent Resource Center (MR4; MRA-1000 and MRA-102), which was developed by the National Institute of Allergy and Infectious Diseases (NIAID) and is managed by the American Type Culture Collection (ATCC) (BEI Resources; https://www.beiresources.org/About/MR4.aspx). Parent parasites used for the generation of the PfΔmei2 and the other gene-deletion mutants were obtained from a characterized good manufacturing process (GMP) produced working cell bank of the WT PfNF5435, produced by Sanaria Inc39,40. WT PfNF54 is sensitive to the following antimalarial drugs: atovaquone/proguanil, arthemeter/lumefantrine and chloroquine41.

For cultivation of P. falciparum blood-stage parasites42, Fresh human serum and human red blood cells (RBC) were obtained from the Dutch National Blood Bank (Sanquin Amsterdam, the Netherlands; permission granted from donors for the use of blood products for malaria research and microbiology tested for safety). Production of genetically modified parasites and characterization of these parasites throughout their life cycle, including mosquito transmission, was performed under GMO permits IG 17-134_II-k en IG 17-135_III.

Generation and genotyping of P. berghei PbΔmei2

The P. berghei mei2 (PBANKA_1122300) gene was deleted by standard methods of transfection43 using a gene-deletion plasmid (PbGEM-300555, pL2206) obtained from PlasmoGEM (Wellcome Trust Sanger Institute, UK; http://plasmogem.sanger.ac.uk)44. This construct is designed to replace the mei2 open reading frame (orf) by the hdhfr::yfcu selectable marker (SM) cassette by double cross-over homologous recombination. The SM cassette contains the hdhfr::yfcu flanked by the P. berghei eef1α promoter region and 3′ terminal sequence of pbdhfr. Before transfection, the construct was linearized by digesting with NotI. Parasites of line 1868cl1 were transfected with construct pL2206 (exp. 2834) and transformed parasites selected by positive selection with pyrimethamine43. Selected parasites were cloned by limiting dilution and cloned lines 2834cl1 and 2834cl2 were used for genotype analysis. Line 2834cl2 was further used to generate the gene-deletion mutant which is SM free. To remove the hdhfr::yfcu SM cassette from the genome of 2834cl2, the parasites were selected (negative selection) by treatment of infected mice with 5-fluorocytosine (5-FC)45. This treatment selects for parasites that have undergone homologous recombination between the two 3′-UTR of pbdhfr untranslated regions present in the integrated construct pL2206, flanking the hdhfr::yfcu cassette and thereby removing the SM46. Selection and cloning of the parasites resulted in the SM-free gene-deletion line PbΔmei2 (2834cl2m1cl1). Correct integration of the construct and deletion of the mei2 gene were confirmed by Southern blot analyses of Pulsed Field Gel (PFG)-separated chromosomes and diagnostic PCR analysis43. To show integration of the PlasmoGem construct containing the hdhfr::yfcu SM or removal of the hdhfr::yfcu SM by negative selection, the PFG-separated chromosomes were hybridized with a mixture of two probes: a probe recognizing the hdhfr gene and a control probe recognizing gene PBANKA_0508000 on chromosome 547. PCR primers for genotyping are listed in Supplementary Table 1.

Phenotyping of P. berghei PbΔmei2

The in vivo multiplication rate of asexual blood stages was determined during the cloning procedure of the different QC mutants48. Infection of ‘, For collection and counting of sporozoites from infected An. stephensi mosquitoes49 mosquito salivary glands were manually dissected (21 days after feeding). Salivary glands were collected in RPMI medium, homogenized and filtered (40 µm Falcon, Corning, NL). Free sporozoites were counted in a Bürker counting chamber using phase-contrast microscopy. The human-hepatoma cell line Huh750 was used for in vitro cultivation of liver-stages. Briefly, 5 × 10(4) isolated sporozoites were added to monolayers of Huh7 cells on coverslips in 24 well plates (with confluency of 80–90%) in complete RPMI-1640 medium supplemented with 10% (vol/vol) fetal bovine serum, 2% (vol/vol) penicillin-streptomycin, 1% (vol/vol) GlutaMAX (Invitrogen), and maintained at 37 °C with 5% CO2. At 24, 48 and 72 hours post infection (p.i.) nuclei were stained with Hoechst-33342 at a final concentration of 10 µM and live imaging of mCherry-expressing parasites was performed using a Leica fluorescence MDR microscope (×40 magnification). Pictures were recorded with a DC500 digital camera microscope using Leica LAS X software with the following exposure times: mCherry: 0.7 s and Hoechst 0.136 s (1× gain). Liver-stage parasite sizes were measured using Leica LAS X software by determining the area of the parasite at its greatest circumference using the mCherry-positive area (µm2).

To determine the attenuation phenotype of PbΔmei2, C57BL/6 mice were infected with 5 × 10(3), 5 × 10(4), or 2 × 10(5) sporozoites of WT or PbΔmei2. Isolated sporozoites, suspended in RPMI-1640 medium, were intravenously injected into the tail vein (200 μl per mouse). Parasite liver loads in live mice were quantified by real-time in vivo imaging51. Parasite liver loads were visualized and quantified by measuring luciferase activity of parasites in whole bodies of mice at 44, 56, and 65 h p.i using the IVIS Lumina II Imaging System (Perkin Elmer Life Sciences, Waltham, USA). D-luciferin was dissolved in PBS (100 mg/kg; Caliper Life Sciences, USA) and 60 µl injected subcutaneously in the neck. Measurements were performed within 8 min after the injection of D-luciferin. Quantitative analysis of the bioluminescence of whole bodies was performed by measuring the luminescence signal intensity (RLU; relative light units) using the ROI (region of interest) settings of the Living Image® 4.5.5 software. Mice were monitored for blood-stage infections by Giemsa-stained blood smears made at day 4 to 30 p.i. The prepatent period (measured in days after sporozoite challenge) is defined as the day when a blood-stage infection with a parasitemia of 0.5–2% is observed47.

Generation and genotyping of four P. falciparum gene-deletion mutants (see Supplementary Table 1 for primer sequences)

PfΔpalm: The palm gene (PF3D7_0602300) was deleted using a CRISPR/Cas9 approach where first a plasmid was introduced into parasites as an episome containing the cas9 gene52, CRISPR/Cas9 system in Plasmodium falciparum using the centromere plasmid53. This plasmid, pLf0086, contains the hdhfr SM (with the P. chabaudi dihydrofolate reductase thymidylate synthase gene promoter (PcDT; PCHAS_0728300) and the cas9 gene (with the P. falciparum heat shock protein 90 gene promoter the (PF3D7_0708400; Pfhsp90). To generate pLf0086, plasmid pLf0070 (pDC2-cam-Cas9-U6.2-hdhfr)54,55 was digested with BamHI to remove the sgRNA/U6 cassette. Re-circularized plasmid in the BamHI site was termed pLf0086. Transfection of WT PfNF54 parasites with plasmid pLf0086 was performed by the method of spontaneous plasmid uptake from plasmid-loaded RBC56. Transfected parasites were selected by treatment with the drug WR99210 (2.6 nM) for a period of two weeks (until parasites were detectable in Giemsa-stained thin blood films) to select for parasites containing the plasmid pLf0086 episomally (Exp.121). Subsequently, selected parasites were simultaneously transfected with two sgRNA/donor DNA plasmids, pLf0124, pLf0125. Both plasmids contain two homology regions (HR) targeting palm, a blasticidin-S-deaminase (bsd) SM cassette (with the P. falciparum hsp70 promoter; Pfhsp70; PF3D7_0818900) and a palm sgRNA cassette. Each plasmid contains a different sgRNA. To generate the palm targeting vectors, a basic plasmid pLf0103 was designed that contains the bsd SM cassette. To generate the bsd SM cassette, a gBlock was designed and ordered (https://eu.idtdna.com/pages), containing the bsd gene flanked by two 34 bp flippase recognition target (frt) sequences (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC;57) (Supplementary Fig. 7). These sequences allow to recycle the SM cassette57. This fragment was cloned into the P. berghei transfection construct pL0034 (RMgm-687; www.pberghei.eu46;) using the restriction enzymes EcoRI/HindIII resulting in intermediate plasmid SKK159. The pfhsp70 promoter was obtained by PCR amplification (KOD Hot Start DNA Polymerase, Merck Millipore) using primers p1/p2 and cloned into the intermediate plasmid SKK159 using the restriction enzymes KpnI/XhoI resulting in the intermediate plasmid SKK160. Finally, the 3′utr of P. falciparum histidine rich protein 2 (Pfhrp2; PF3D7_0831800) was obtained by PCR amplification (KOD Hot Start DNA Polymerase, Merck Millipore) using primers p3/p4 and cloned into SKK160 using the restriction enzymes NotI/AvrII resulting in the final basic plasmid pLf0103. This construct contains additional restriction sites for introducing homology/targeting sequences to target any gene of interest, such as NaeI/SacII and ApaI/HindIII and for introducing the sgRNA/U6 cassettes, such as AatII/ BamHI (see below). Plasmid pLf0039 with the P. falciparum u6 RNA promoter (PF3D7_1341100) containing the BtgZI adaptor58 was used two generate two sgRNA expression cassettes for two intermediate plasmids containing sgRNA009 (pLf0110) and sgRNA010 (pLf0111). The guide sgRNA sequences for palm (sgRNA009 and sgRNA010) were identified using the Protospacer software (alpha version; https://sourceforge.net/projects/protospacerwb/files/Release/) and were amplified using the primers p5/p6 and p7/p8. These sgRNAs were selected based on the best off target hits score throughout the genome given by Protospacer and the total number of mismatches of the sgRNA with respect to the Protospacer adjacent motif site. Two 20 bp primer guide sgRNAs, surrounded by 15 bp vector-specific DNA necessary for InFusion cloning (HD Cloning Kit; Clontech), were annealed and used to replace the BtgZI adaptor58, resulting in intermediate plasmids pLf0100, pLf0101, that were digested with BlnI/ NruI for evaluation successful cloning and confirmed by Sanger sequencing using primers p9/p10. These constructs contain additional restriction sites for lifting the complete u6 cassette including the sgRNA, such as AatII/BamHI (see below). Next, two different sgRNA/donor DNA constructs, containing each of the sgRNA as well as the donor DNA sequences, were generated in multiple cloning steps resulting in pLf0124 and pLf0125. These constructs contain both the sgRNA expression cassettes and the bsd SM cassette. To generate the palm targeting vectors, plasmid pLf0103 was modified by introducing two HRs, HR1 and HR2, targeting palm. HR1 was amplified using primers P11/12 and HR2 with p13/p14 from WT PfNF54 genomic DNA. HR2 was cloned into pLf0103 using restriction sites ApaI/HindIII, resulting in intermediate plasmid F171. Subsequently, HR1 was cloned into F171 using NaeI/SacII, resulting in intermediate plasmid pLf0110 (F177). These plasmids are used to introduce sgRNA/U6 cassette from the intermediate plasmids pLf0100 and pLf0101, containing sgRNA009 and sgRNA010 respectively (using restriction sites AatII/ BamHI) to generate pLf0124 and pLf0125, respectively.

Parasites of Exp.121 were transfected with the two plasmids pLf0124 and pLf0125 (a mixture of 50 μg of each circular plasmid in 200 μl cytomix) using standard transfection methods59. Selection of transfected parasites was performed by applying double-positive drug pressure from day 3 until day 9 after transfection using the drugs WR99210 (2.6 nM) and Blasticidin (BSD, 5 µg/ml). On day 9 drug pressure was removed and parasites were maintained in drug-free medium until parasites were detectable in thin blood-smears (day 15 after transfection). Selected parasites were then grown without both drugs until the parasitemia reached over 10%, followed by a second BSD selection (5 µg/ml) for a period of 7 days, resulting in parasite population Exp.167 (PfΔpalm-1) and Exp.169 (PfΔpalm-2). After drug selection, diagnostic PCR42 was performed from material isolated from iRBC. Correct replacement of the palm gene with the bsd cassette in the parasites after the second BSD selection in PfΔpalm-1 and PfΔpalm-2 parasites was confirmed by long-range PCR amplification (LR-PCR) (primers P15/P16) and standard PCR amplification of the palm open reading frame (primers p17/p18) and the bsd SM cassette (primers p19/p20). The PCR fragments were amplified using KOD Hot Start Polymerase (Merck Millipore) following standard conditions with annealing temperatures of 50.5 and 51 °C for 25 s and an elongation step of 68 °C for 3 min.

PfΔcbr: The Pfcbr gene (PF3D7_1367500) was deleted in WT PfNF54 parasites by standard methods of CRISPR/Cas9 transfection58,59 using a sgRNA-expressing plasmid pLf0178, containing the cas9 expression cassette, guide-RNA expression cassette and an hdhfr SM cassette, in combination with a donor DNA plasmid pLf0179 that contains a bsd SM cassette (linked to gfp, and separated with skip peptide 2 A; bsd-2A-gfp) for positive selection and a yfcu SM cassette for negative selection. The sgRNA-expressing plasmid was generated as follows: pLf007054 was digested with BbsI and the sgRNA067 was selected using the CHOPCHOP webtool (https://chopchop.cbu.uib.no/)60 and subsequently cloned into the pLf0070 using primers p21/p22. In brief, the primers (100 µM each primer) were phosphorylated with T4 polynucleotide kinase (10 Units per reaction) during 30 min at 37 °C, followed by an annealing program of 5 min incubation at 94 °C and a ramp down to 25 °C at 5 °C per min, and subsequently ligated into the BbsI digested pLf0070 vector using T4 ligase (5 units) resulting in the plasmid pLf0178.

The donor DNA plasmid pLf0179 was generated to replace the Pfcbr open reading frame with the bsd SM cassette linked to gfp (bsd-2A-gfp). For generation of pLf0179, the HR1 and HR2 regions of Pfcbr were amplified from WT PfNF54 genomic DNA using primers p23/p24 and p25/p26. Fragments were digested with HindIII/ApaI and NheI/BamHI respectively and ligated into plasmid pLf0169 to obtain pLf0179. Plasmid pLf0169 was generated as follows: a new gBlock was designed and ordered (https://eu.idtdna.com/pages), containing the bsd-2A-gfp genes flanked by the two frt sequences. This fragment was cloned into the intermediate construct pL0f103 (see above) to replace the bsd cassette by bsd-2A-gfp using the restriction sites BsabI/AvrII, resulting in the intermediate plasmid pLf0165. A second intermediate plasmid F213 was created amplifying the complete yfcu SM cassette controlled by the pfhsp90 promoter and the 3′ terminator sequence from P. berghei dihydrofolate reductase thymidylate synthase gene (Pbdhfr/ts; PBANKA_0719300; 3′PcDT, PCHAS_0728300), from the existing vector pLf0003 (pHHT-FRT-Pf3657) using the primers p27/p28. The complete cassette was cloned into the vector pJET1.2/blunt (thermo scientific) using the restriction enzyme EcoRV. Finally the yfcu SM cassete from the F213 plasmid was subcloned into the vector pLf0165 using the restriction sites StuI for the pLf0165 and PvuII/StuI for the yfcu SM, resulting in the plasmid pLf0169.

Transfection of WT PfNF54 parasites with plasmids pLf0178 and pLf0179 was performed by spontaneous plasmid uptake from plasmid-loaded red blood cells cultured59. Transgenic parasites were selected by applying ‘double’ positive selection 72 h after transfection with the drugs WR99210 (2.6 nM) and BSD (5 µg/ml) during 7 days. Subsequently, both drugs were removed from the cultures until thin blood-smears were parasite-positive, followed by applying negative selection by addition of 5-FC (1 µM) in order to eliminate parasites that retained the Donor DNA construct as episomal plasmid. Negative drug pressure in the cultures was maintained until thin blood-smears were parasite-positive. After negative selection parasites (Exp. 236) were harvested for genotyping by diagnostic PCR and Southern analysis58,59. To confirm the integration and the presence of the bsd-2A-gfp cassette, 5′-integration, 3′ integration, and bsd, PCRs were performed using the primers p29/p30, p31/p32 and p20/p33 respectively. In addition the absence of the pfcbr open reading frame was confirmed using the primers p34/p35. The PCR fragments were amplified using KOD Hot Start Polymerase (Merck Millipore) following standard conditions with annealing temperatures of 50, 55, 60 °C for 10 s and an elongation step of 68 °C. Southern blot analysis was performed with gDNA digested with EcoRI and NcoI (4 h at 37 °C) in order to confirm the deletion of Pfcbr. Digested DNA was hybridized with a probe targeting the Pfcbr HR2, amplified from WT PfNF54 genomic DNA by PCR using primers p25/p26, and the ampicillin probe (amp), was amplified using primers p36/p37.

PfΔhcs1: The Pfhcs1 gene (PF3D7_1026900) was deleted in WT PfNF54 parasites by standard methods of CRISPR/Cas9 transfection58,59 using two different sgRNA-expressing plasmids, containing the cas9 expression cassette, guide-RNA expression cassettes, and hdhfr SM cassette, in combination with donor DNA plasmid pLf0191 that contains a bsd-2A-gfp SM cassette. The two different sgRNA-expressing plasmids were generated as follows: pLf007054 was digested with BbsI and sgRNA074 and sgRNA075 (selected with CHOP-CHOP webtool) were cloned using primers p38/p39 and p40/p41, respectively, resulting in the plasmids pLf0193 and pLf0194. The donor DNA plasmid pLf0191 was generated to replace the Pfhcs1 open reading frame with a bsd-2A-gfpSM cassette flanked by two frt sequences. The HR1 and HR2 targeting regions of Pfhcs1 were amplified from WT PfNF54 genomic DNA using the primers P42/P43 and P44/P45 respectively (Supplementary Table 1). Fragments were digested with HindIII/AscI and SacII/NheI and ligated into plasmid pLf0169 to obtain pLf0191. Transfection of WT PfNF54 parasites with constructs pLf0191, pLf0193, and pLf0194 was performed by spontaneous plasmid uptake from plasmid-loaded red blood cells cultured59 and selection of PfΔhcs1 parasites was as described above for generation of PfΔcbr, resulting in the line PfΔhcs1 (Exp. 252). For genotyping PfΔhcs1 parasites, diagnostic PCR was performed. To confirm the integration and the presence of the bsd-2A-gfp cassette, 5′-integration, 3′ integration PCRs were performed using the primers p46/p47, p48/p49 respectively, additionally the absence of the pfhcs1 open reading frame was confirmed using the primers p50/p51. The PCR fragments were amplified using Phusion DNA Polymerase (NEB) following standard conditions with annealing temperatures of 58 °C for 30 s and an elongation step of 68 °C.

PfΔmei2: The mei2 gene (PF3D7_0623400) was deleted in WT PfNF54 parasites by standard methods of CRISPR/Cas9 transfection58 using a donor DNA plasmid pLf0105 and two different sgRNA-donor containing plasmids, pLf0080 and pLf0092, targeting the mei2 gene.

For generation of plasmid pLf0105, two homology regions targeting the mei2 gene were introduced in pLf0103. HR1 was amplified from WT PfNF54 genomic DNA using primers P52/P53 and HR2 with primers P54/P55. The PCR fragments were sequenced after TOPO TA (Invitrogen) subcloning and subsequently cloned into pLf0103 using restriction sites NaeI/SacII and ApaI/HindIII, resulting in plasmid pLf0105. To generate the two sgRNA-donor-containing vectors, plasmid pLf007054 was digested with BbsI and sgRNA030 and sgRNA032 were cloned, as described above, using primers P56/P57 and P58/P59, respectively, resulting in the plasmids pLf0080 and pLf0092. Transfection of WT PfNF54 (Leiden vial 9002 obtained from Nijmegen; NF54 54/329 4514) with constructs pLf0105, pLf0080 and pLf0092was performed by spontaneous plasmid uptake from plasmid-loaded RBC59. Selection of transfected WT PfNF54 parasites was performed by applying double positive selection (as described for selecting for generation of PfΔcbr) for a period of 6-19 days. After this treatment period with two drugs, cultures were maintained in drug-free medium until parasites were detectable in Giemsa-stained thin blood smears (a period of three weeks). Subsequently, parasites were treated for one week with BSD (5 μg/ml), resulting in parasite population Exp.151 (PfΔmei2a parasites; Fig. 1). Subsequently, selected parasites were cloned by limiting dilution. In order to remove the bsd SM cassette from the genome of PfΔmei2a, blood stage parasites of the uncloned population of PfΔmei2-a (Exp. 151) were transfected with plasmid pLf0120 that contains a flpe recombinase expression cassette (Fig. 1). To create plasmid pLf0120, we used plasmid pMV-FLPe57 (pLf0038) that contains a bsd SM cassette and an flpe recombinase expression cassette. We first replaced the bsd SM cassette of plasmid pMV-FLPe with the hdhfr-yfcu SM cassette of plasmid pLf003958 (HindIII/KpnI) to create pLf0120. The hdhfr-yfcu gene is flanked by the promoter of the Pfhsp86 and the Pbdhfr/ts short (0,5 kb) terminator sequences. The flpe gene is flanked by the promoter of the Pfhsp90 from PfDd2 strain (PfDd2_070012600;) and Pbdhfr/ts long (1 kb) terminator sequences. After transfection of PfΔmei2a blood stages with pLf0120 (as described above), cultures were treated for a period of six days (day 3–9) with WR99210 (2.6 nM), followed by a period of 2 weeks culture without WR99210 treatment. Subsequently, selected parasites were cloned by limiting dilution. DNA from iRBC was obtained from 10 ml cultures (parasitemia 3–10%). Diagnostic PCR was performed using primer pair (P60/P61). As a control, the gene p47 (PF3D7_1346800) was PCR amplified using primers 8428/8756 (P62/P63). Southern blot analysis was performed with gDNA digested with XmnI (4 h at 37 °C) in order to confirm the deletion of Pfmei2. Digested DNA was hybridized with probes targeting the Pfmei2 (a fragment of 539 bp of the mei2 coding sequence amplified using primers P64/P65, Pfp47 gene (PF3D7_1346800, as a control fragment of 3910 bp, amplified using primers P62/P66), ampicillin gene (amp probe; amplified using primers P36/P37), the bsd SM (amplified using primers P67/P20), the cas9 (amplified using primers P68/P69 and the flpe gene (amplified using primers P70/P71). In order to confirm the precise nature of the genetic deletion, a PCR product that encompass the mei2 gene-deletion region of PfΔmei2 was cloned and sequenced. This PCR product was obtained using primer pair P72/P73, cloned in pJET (Thermo Fisher Scientific) and sequenced using primers P74/P75.

Phenotyping of P. falciparum mutants PfΔpalm, PfΔhcs1 and PfΔcbr

The growth rate of asexual blood-stages (parasitemia) was monitored by determination of parasitemia in standard in vitro cultures (in a semi-automated shaker incubator system) for a period of 4 days with a starting parasitemia of 0.1%42. Parasitemia was determined by counting infected RBC in Giemsa-stained thin blood films in three independent experiments. Gametocyte production and exflagellation54 were quantified in gametocyte cultures.

For analysis of mosquito stages (oocysts and sporozoites) An. stephensi mosquitoes were infected with day 14 gametocyte cultures using the standard membrane feeding assay (SMFA)59,61. Oocysts and salivary gland sporozoites were counted at days 9 and day 21 p.i., respectively. For counting sporozoites, salivary glands from 10 to 15 mosquitoes were dissected, collected in 100 µl of PBS and homogenized using a grinder. Sporozoites were counted using a Bürker cell counter using phase-contrast microscopy.

Oocysts were analyzed in manually dissected midguts using a Leica MZ16 FA stereo-fluorescent microscope. The midguts were imaged with a Leica MZ camera at ×10 magnification using Leica LAS X software. Individual oocysts were observed under a Leica DM2500 light microscope and documented with at ×100 using Leica DC500 digital camera using Leica LAS X software. Sg-sporozoite numbers were analyzed in infected mosquitoes at day 18–21 p.i. For counting sporozoites, salivary glands from 30–0 mosquitoes were dissected and homogenized using a grinder in 100 μl of RPMI-1640 medium (pH 7.2) and sporozoites were analyzed in a Bürker cell counter using phase-contrast microscopy54.

Phenotyping of P. falciparum mutant PfΔmei2

The growth rate of asexual blood-stages and analysis of mosquito stages (oocysts and sporozoites) in An. stephensi mosquitoes were performed as described in the previous section for the other three gene-deletion mutants.

BioIVT hepatocytes: Analysis of the development of WT PfNF54 and PfΔmei2 parasites in primary human hepatocytes58 was performed as follows. Liver-stages of WT PfNF54 and PfΔmei2 were cultured in vitro using cryopreserved primary human hepatocytes obtained from BioIVT (Belgium) and thawed according to the instructions of the manufacturer. Cells were seeded at a density of 60,000 cells/well in a collagen-coated 96-well clear-bottomed black plate for 2 days. Medium was refreshed daily (hepatocyte medium: Williams’s E medium supplemented with 10% heat-inactivated fetal bovine serum, 2% penicillin-streptomycin, 1% fungizone, 0.1 lU/ml insulin, 1.6 μM dexamethasone). Per well, 7 × 104 freshly dissected WT PfNF54 and PfΔmei2 sporozoites were added to the hepatocyte monolayer. After a quick spin (10 min at 1900 g), the plate was incubated at 37 °C under 5% CO2. The medium was replaced with fresh hepatocyte culture medium 3 h p.i., and daily for 9 days thereafter. At days 3, 5, 7, and 9 p.i., hepatocytes were fixed with 4% paraformaldehyde in 1× PBS for 30 min. After fixation the wells were washed three times with 1× PBS and permeabilized with 300 μl of 0.5% triton in 1× PBS during 1 h and then blocked with 10% of FCS in 1× PBS for 1 h. Fixed cells were washed with 1× PBS and standard IFA was performed using antibodies against (1) the cytoplasmic protein PfHSP70 (PF3D7_0818900; rabbit anti-PfHSP70-PE/ATTO 594 conjugated primary antibody; 1:200 dilution of 100 μg/ml stock solution StressMarq, Biosciences, NL); (2) the plasma membrane surface protein MSP1 (PF3D7_0930300; mouse monoclonal antibody 1:1000 of 4.0 mg/ml stock solution obtained from The European Malaria Reagent Repository, Edinburgh, UK) (3) and the parasitophorous membrane protein EXP1 (PF3D7_1121600, mouse monoclonal antibody (1:200 of 4.0 mg/ml stock solution obtained from The European Malaria Reagent Repository, Edinburgh, UK). In addition, cells were stained with Hoechst-33342 for nuclear staining. Cells were mounted in Image-iT signal Enhancer (Invitrogen Thermofisher, USA) and examined with a SP8 Leica confocal microscope at ×100 magnification. Number of infected hepatocytes, antibody staining, and size of parasites were analyzed using ImageJ.

LONZA hepatocytes: Cryopreserved primary human hepatocytes purchased from Lonza Bioscience were thawed and seeded in μ-Slide 18 Well ibiTreat coverslip (IBIDI, Gräfelfing, Germany), pre-coated with rat-tail collagen I (BD Bioscience, USA) in William’s E medium (Gibco) supplemented with 10% fetal clone III serum (FCS, Hyclone), 100 u/mL penicillin and 100 ug/mL streptomycin (Gibco), 5 × 10−3 g/L human insulin (Sigma-Merck), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB, France) at 37 °C in 5% CO2. The next day, cells were overlaid with matrigel (Corning) and medium was then renewed every 2 days. Three days later, sporozoites were isolated by aseptic hand dissection of salivary glands of PfΔmei2- and WT PfNF54-infected mosquitoes. Matrigel was removed from hepatocyte culture and 30,000 sporozoites were inoculated to cells before centrifugation at 560×g for 10 min at RT and further incubation at 37 °C, 5% CO2. Three hours later, infected cultures were covered with matrigel prior to addition of fresh cell culture medium. Medium was renewed every day, until cell fixation at the chosen times. Infected cultures were fixed with 4% paraformaldehyde for 15 min at room temperature and liver-stage parasites were immunostained with polyclonal anti-PfHSP70 murine serum prepared in the lab, anti-PfEXP1 (kindly provided by Pr Jude Przyborski) and revealed with anti-mouse IgG Alexa Fluor® 594 and anti-rabbit IgG Alexa-Fluor 488-conjugated, respectively (Invitrogen). DAPI was added to visualize nuclei. Parasite number and size were determined using a Cell Insight High Content Screening platform equipped with the Studio HCS software (Thermo Fisher Scientific) at the CELIS platform (ICM, La Pitié-Salpêtière, Paris). Graphs and statistical analysis were done using Prism 8.4.3 software. The areas of parasites were compared using the Mann–Whitney U test.

Liver stage development of both PfΔmei2 and WT PfNF54 parasites were analyzed in liver-chimeric humanized mice (FRG huHep mice) purchased from Yecuris Corporation (Tualatin, OR) and housed at Oregon Health and Science University (OHSU) as per manufacturer’s recommendation. All studies were performed according to the regulations of the Institutional Animal Care and Use Committee (IACUC; protocol IP00002077). Female An. stephensi mosquitoes, aged 3–5 days, were infected with PfΔmei2 and WT PfNF54 at LUMC (Leiden, the Netherlands)54,59. 12 days after feeding, mosquitoes were shipped to OHSU. Sporozoites were isolated by salivary gland dissection from infected mosquitoes at day 16 p.i. at OHSU for infection of the FRG huHep mice. Isolated salivary gland sporozoite were run over glass wool to remove contaminating mosquito material and sporozoites enumerated by hemocytometer. FRG huHep mice (PfNF54 WT n = 4; PfΔmei2 n = 7) were infected by intravenous injection (retro-orbital injection) of 10(5) sporozoites in a 100 µl volume of phosphate buffered saline. Five days p.i., FRG huHep mice were injected intravenously with 400 µl freshly washed human type AB red blood cells (RBC; 70% hematocrit) supplemented with 0.035 mg/mouse clodronate (Formumax CloLip) and penicillin/streptomycin antibiotic (50 units penicillin, 50 µg streptomycin/ml, Sigma). The following day, FRG huHep mice were injected intraperitoneally with 700 µl freshly washed human type AB RBC (70% hematocrit). At 7 and 9 p.i. 100 µl of blood was collected into 2 ml NucliSens buffer (Biomerieux) for qRT-PCR analysis. At day 9 p.i. mice were euthanized and blood collected for cryopreservation in glycerolyte. To analyze the presence of blood stages in blood samples collected from the FRG huHep mice (day 7, 9) 18 S qRT-PCR62 quantification of blood-stage parasites was performed. In addition to the qRT-PCR analyses, the cryopreserved blood of all FRG huHep mice (collected at day 9) was used for in vitro cultivation of parasites, performed at the LUMC (Leiden, the Netherlands), to assess the presence/absence of