Recombinant RNase A expression and evaluation

pET22b RNase A was a gift from Ronald Raines (Addgene plasmid # 58903; http://n2t.net/addgene:58903; RRID:Addgene_58903) (delCardayre et al. 1995). The RNase A expression plasmid was obtained from Addgene with T7 promoter, ampicillin resistance, and bovine pancreatic RNAase A gene ORF. The purchased plasmid was in DH5 alpha cells which are used for cloning and plasmid storage with minimum mutagenesis activity. GeneDireX miniprep kit (Simply™) was used to purify the plasmid from DH5 alpha cells. Around 50 ng of the purified plasmid was used to transform chemically prepared competent BL21 star DE3 (Invitrogen) E.coli strain, then plated on LB agar plates (containing 50 µg/ml Ampicillin). Selected colony was inoculated into a 10 ml LB medium containing ampicillin (50 μg/ml) and cultivated overnight at 37 °C. In the next day, the overnight culture was added to 200 ml selective cultures which have been induced by adding IPTG ( 5 mM) at OD600 0.6. After induction for 24 and 48 h, cultures were centrifuged at 7000 g and 4 °C and pellets were resuspended in 0.5 mL of PBS buffer and sonicated. The RNase expression was visualized using SDS-PAGE in comparison to uninduced control (El-Dabaa et al. 2022).

RNase A recombinant protein was mainly in inclusion bodies (IB). Therefore, inclusion bodies were purified using mechanical homogenizer and different kind of buffers (TNMFX-2 M Urea (50 mM tris-base, 150 mM NaCl, 1 mM EDTA, 2 M Urea, PH 8), PBST, 8 M urea, and TNMFX-0.1% Triton X100) following a protocol from Proteintech, Japan (www.ptglab.com). Purified inclusion bodies were solubilized in 8 M urea solution containing 0.2 M Tris–HCl, pH 8.5 and 0.1 M (β-mercaptoethanol) for protein reduction. The denatured protein was refolded using rapid dilution in refolding buffer (30 mM Tris–HCl, pH 8.5, 0.5 mM oxidized glutathione, 3 mM reduced glutathione, 0.4 M L Arginine) (Futami et al. 2000). To test the activity of RNase A, crude RNase refolding reaction and RNase inclusion bodies (as control with non-folded, non-reactive RNase) were incubated with total RNA purified from HepG2 cells. The crude refolded RNase was used directly in the plasmid miniprep as described later.

Plasmid miniprep solutions preparation

The main composition of buffers was retrieved from online OpenWetware (https://openwetware.org/wiki/Qiagen_Buffers) and composed with slight modifications. The solutions were prepared as the following: P1 lysis Buffer (50 mM Tris–HCL PH 8, 10 mM EDTA), P2 buffer (200 mM NaOH, 1% SDS), N3 neutralization buffer (4.2 M GuHCL, 0.9 M CH3COOK, pH 4.8), PB buffer (5 M Gu-HCL, 30% ethanol), and PE buffer (10 mM Tris–HCL pH 7.5, 80% EtOH). EZ-10 spin columns were purchased from BioBasic, Canada.

Miniprep protocolLysis 1

1.2 ml of transformed bacterial culture was harvested by centrifugation at 4000×g.

2

The bacterial pellet was resuspended in 250 µl of P1 lysis buffer and 5 µl of crude refolded RNase.

3

250 µl of P2 buffer was added and mixed by inverting for 5–7 times to get a clear solution (do not incubate it more than 5 min).

4

350 µl of N3 buffer was added and inverted immediately for 5–7 times, followed by centrifugation for 10 min at 13000×g.

5

750 µl from supernatant of the previous step was applied to a spin column tube then centrifuge for 30–60 secs at 10000×g. Then the flow-through was discarded.

Washing 1.

The spin column was washed by 500 µl of PB buffer then centrifuged for 30–60 secs at 10,000×g, followed by discarding the flow-through.

2.

750 µl of PE buffer was added to the spin column and centrifuged for 30–60 secs at 10000×g.

3.

After discarding the flow-through, to get rid of any washing contaminants, an additional centrifugation step at 10000×g for 1 min at full speed was executed.

Elution 1.

The spin column was transferred into clean 1.5 ml microcentrifuge tube.

2.

30-50 µl of ddH2O was added and incubated for 5 min at room temperature, then was centrifuged for 1 min at full speed.

3.

The previous step was repeated for one more time.

4.

The eluted plasmid was stored at −20 °C.

ValidationPlasmid miniprep preparation

To test our homemade solutions, DH5 alpha cells were transformed with of px48SpCas9 (1.1). The plasmid which was kindly provided by Ole M. Seternes (UiT, Norway). Then, our miniprep solutions were utilized in comparison with commercial kit from GeneDirex. The extracted plasmids were evaluated by electrophoresis on 1.5% agarose gel and visualized by UV-transilluminator.

PCR amplification

In addition, for extra validation of prepared plasmid purity, a PCR was done using specific primers for this plasmid. (LD F: 5′ acggatcgacctgtctcagc 3′ and LD300 R: 5’ ccggtggtgcagatgaactt 3′).

Homemade DNA Ladder preparation

The purified px48SpCas9 (1.1) plasmid was used as a PCR template to make DNA ladder. Primers were designed to match the plasmid sequence to give 7 PCR products ranging from 100 bp to 1.5 kb (Table1). Gradient temperature ranging from 57 to 67 °\(\mathrm\) was tested to optimize each PCR fragment. The gradient range of annealing temperature was selected ± 5 °C of melting temperature of the synthesized primers.

Table 1 Primers used for PCR amplification of DNA ladder different fragments