Cell culture, DNA construction, transfection and drug administration

The immortal human retinal pigment epithelium cell line ARPE-19 was purchased from ATCC (Manassas, VA, USA). The cells were cultured in Dulbecco’s modified Eagle’s medium /Nutrient Mixture F-12 (DMEM/F-12) supplemented with 10% fetal bovine serum in a humidified incubator at 37 °C under 5% CO2. To knockdown SHP-1 in ARPE-19 cells, we used short hairpin RNA specific to human SHP-1 recombinant lentivirus (shRNA-SHP-1-rLV; Taitool Bioscience, Shanghai, China). The target sequence of human SHP-1 was 5’- CCTTGAGCAGGGTCTCTGCATCC-3’. The scramble sequence was 5’- CGCTGAGTACTTCGAAATGTC-3’. The sequences were inserted into the pLentai-hU6-shRNA (or scramble)-hEF1α-PuroR lentiviral vector. ARPE-19 cells were incubated with medium containing the virus (multiplicity of infection = 15) for 24 h. Then, the medium was refreshed, and the cells were cultured for another 48 h. The cell lysates were collected to determine the SHP-1 expression levels by western blotting. ARPE-19 cells transfected with scramble-rLV were used as control. atRAL(Sigma, St.Louis, MO, USA), a STING covalent antagonist (H151; Selleck Chemicals, Houston, TX, USA) and an AMPK inhibitor (Compound C; Selleck Chemicals), were dissolved and stored in the dark at -80 °C until use. The reagents were diluted with culture medium to an appropriate concentration immediately before use.

Cell viability assay

The same numbers of cells were first seeded in 96-cell microplates. When cell confluence had reached 80%, the pretreated or untreated cells were incubated with culture medium supplemented with different concentrations of atRAL for 24 h. The medium was then replaced with fresh medium mixed with Cell Counting Kit-8 (CCK-8) reagents (Dojindo, Kumamoto, Japan). After incubation for 2 h, the color in each well was detected and analyzed using multimode microplate reader (Spark, Tecan, Männedorf, Zürich, Switzerland).

Cell ATP assay

A CellTiter Glo Assay (Promega, Madison, WI, USA) was used to measure the ATP level in ARPE-19 cells. After equilibration at room temperature for 30 min, 100 μL of CellTiter Glo reagent was added to each well of white 96-well microplates. The microplates were immediately shaken for 2 min for complete cell lysis and the reaction. The microplates were then incubated for another 10 min at room temperature to stabilize the luminescence, which was measured using the microplate reader (Tecan).

Annexin V-fluorescein isothiocyanate (FITC)/Propidium Iodide (PI) staining

An Annexin V-FITC Apoptosis Detection Kit (BD Biosciences, San Diego, CA, USA) was used to measure apoptosis. Briefly, after being washed twice with cold phosphate-buffered saline (PBS), the cells were digested with accutase (Invitrogen, Carlsbad, CA, USA) at room temperature and centrifuged at 300 g for 5 min for harvest. Then the cells were resuspended in binding buffer containing Annexin V-FITC and PI. The cell suspensions were gently vortexed and incubated in the dark for 15 min. Finally, flow cytometry was performed using a MoFlo XDP flow cytometer (Beckman Coulter, Miami, FL, USA) and analyzed using FlowJo software (TreeStar, Ashland, OR, USA).

Mitochondrial Membrane Potential (MMP) Assay

A decrease in MMP is regarded as an early event in mitochondria-dependent apoptosis. We measured MMP using the JC-1 staining kit (Beyotime, Shanghai, China) according to the manufacturer’s instruction. In this assay, if MMP decreases, the fluorescence of JC-1 shifts from red (aggregated) to green (monomeric). Briefly, after being treated with atRAL for 12 h, the cells were refreshed with culture medium and an equal amount of JC-1 staining working solution at 37 °C for 20 min. The cells were then washed twice with ice-cold JC-1 staining buffer solution. Finally, the cells were placed in complete culture medium and viewed under an inverted fluorescence microscope (Leica, Wetzlar, Germany).The mean fluorescence intensities (red and green) were measured using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Immunocytochemistry, mitochondria labeling, and mitochondria morphology analysis

The ARPE-19 cells were seeded onto coverslips, cultured, and treated with the specific drugs. The coverslips were then fixed with 4% formaldehyde at room temperature for 15 min. After being rinsed in PBS briefly, the coverslips were blocked and permeabilized in 5% goat serum and 0.3% Triton X-100 for 30 min. Next, the coverslips were incubated with the following primary antibodies at 4 °C overnight: mouse anti-SHP-1(610125, BD Biosciences); rabbit anti-calnexin (2679, Cell Signaling Technology, Danvers, MA, USA); rabbit anti-STING (198151-1-AP, Proteintech, Chicago, IL, USA); and rabbit anti-translocase of outer mitochondrial membrane 20 (TOMM20) (ab186735, abcam, Cambridge, UK). The coverslips were then incubated with Alexa Fluor 488-goat anti-mouse or Alexa Fluor 555-goat anti-rabbit secondary antibodies (Invitrogen) for 1 h at room temperature. After brief rinses, nuclei of cells were stained with 4',6-diamidino-2-phenylindole (DAPI) mounting medium (ab104139, Abcam). Finally, immunofluorescent images were taken with a laser confocal microscope (Leica).

To assess mitochondrial morphology, the acquired images were quantitatively analyzed with Mitochondria Analyzer, a publicly available plugin for ImageJ software as previously described (Chaudhry et al. 2020). The parameters included aspect ratio (AR) and form factor (FF) values. An AR value (the ratio of the length of major to minor axis) of 1 represents a circle. The AR value increases with elongation of the mitochondrion. An FF value (perimeter2/4π × area) of 1 indicates a simple unbranched mitochondrion. The FF value increases as the mitochondrial network develops into a more complex structure with more branching/elongation.

The abundance of mitochondria in live ARPE-19 cells was also estimated by MitoTracker Deepred (Dojindo) labeling. Briefly, the ARPE-19 cells were incubated with culture medium containing 1 μM of MitoTracker Deepred at 37 °C for 30 min. After being rinsed with PBS, the cells were digested with accutase and the cell suspensions were immediately analyzed by flow cytometry. The mean MitoTracker fluorescence intensities were measured using FlowJo software (TreeStar).

Mitochondrial DNA (mtDNA) copy number

Genomic DNA, including mtDNA, was extracted from ARPE-19 cells using TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China), and the mtDNA copy number was evaluated by real-time quantitative PCR. Real-time quantitative PCR was performed using the CFX RT-qPCR detection system (Bio-Rad, Hercules, CA, USA) with the following reaction conditions: 95 °C for 10 min (pre-degeneration), and 40 cycles of 95 °C for 15 s (degeneration) and 60 °C for 30 s (annealing and extension). The melting curves were obtained. The mitochondria-encoded NADH dehydrogenase subunit 1 (mt-ND1), and mitochondria-encoded cytochrome c oxidase III (mt-CO3) were chosen to represent mtDNA, and β-actin was chosen to represent nuclear DNA (nDNA). The following primers sequences were used (forward and reverse): mt-ND1, ATACCCATGGCCAACCTCCT and GGGCCTTTGCGTAGTTGTAT; mt-CO3, ATGACCCACCAATCACATGC and ATCACATGGCTAGGCCGGAG; β-actin, CGAGAAGATGACCCAGGTGAGT and GAGAGACAAACACCAGAAAAAGAGC. The mtDNA copy number was determined by analyzing the ΔΔCt for mt-ND1 and mt-CO3 normalized to β-actin.

Western blotting and immunoprecipitation

The ARPE-19 cells were lysed in lysis buffer (Beyotime) supplemented with phenylmethylsulfonyl fluoride and protease inhibitor cocktail (Beyotime) on ice. The lysates, after brief ultrasonic treatment, were centrifuged at 13.6 × 103 g for 5 min at 4 ℃. The protein concentration of the collected supernatants was determined using a BCA protein assay kit (Beyotime). The supernatants were mixed with the 5 × sample loading buffer and boiled at 95 °C for 5 min.

For immunoprecipitation, the supernatants were first incubated with the antibody on a shaker at 4 °C overnight. Then AG beads (Millipore, Billerica, MA, USA) were added to the supernatant and incubated at 4 ℃ for 2 h. The mixture was centrifuged at 4 °C and rinsed gently with PBS-Tween buffer three times. The precipitates were boiled with loading buffer as mentioned above. The samples were then separated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane (Millipore). After being blocked with 5% nonfat milk for 1 h, the membranes were incubated with the following primary antibodies at 4 °C overnight: rabbit anti-SHP-1(ab32559, abcam); rabbit anti-TOMM20 (ab186725, abcam); rabbit anti-Bcl-xL (ab2764, abcam); rabbit anti-STING(19,851-1-AP, Proteintech); rabbit anti-K63-linkage polyubiquitin (5621, Cell Signaling Technology); rabbit anti-K48-linkage polyubiquitin (8081, Cell Signaling Technology); mouse anti-peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) (66369-1-Ig, Proteintech); rabbit anti- nuclear factor erythroid 2-related factor 2 (nrf2) (ab137550, abcam); rabbit anti-phospho-AMPKα(Thr172) (2535, Cell Signaling Technology); rabbit anti-AMPKα (207442, abcam); rabbit anti-phospho-TANK-binding kinase 1 (TBK1; Ser172) (5483, Cell Signaling Technology); rabbit anti-TBK1 (3504, Cell Signaling Technology); and rabbit anti-β-actin (AF7018, Affinity Biosciences). After being rinsed in TBST three times, the membrane was incubated with the corresponding horseradish-peroxidase conjugated secondary antibody (Millipore) for 1 h at room temperature. The blots were visualized using an enhanced chemiluminescence fluid (Millipore).

Animal treatment, RPE flat mount and immunohistochemistry

Male BALB/c albino mice aged 8 to 10 weeks were kept on a 12 h dark/light cycle, with plenty food and water. The shRNA-SHP-1-rLV specific to murine SHP-1 (Taitool Bioscience) was used to knockdown SHP-1 in murine RPE (mRPE) in vivo. The target sequence of murine SHP-1 was 5’-GGACATTTCTTGTGCGTGA-3’.We gave a subretinal injection of 1μL of shRNA-SHP-1-rLV into the left eyes. The right eyes received an equivalent volume of scramble-rLV as control. After 2 weeks, the mice were sacrificed and eyes were enucleated and fixed in 4% formaldehyde for 30 min. The RPE flat mounts were prepared as described previously with some modification (Felszeghy et al. 2019). The mounts were treated with 5% goat serum and 0.3% Triton X-100 for 1 h, and then incubated with primary antibodies at 4 °C overnight: mouse anti-SHP-1(610125, BD Biosciences); rabbit anti-TOMM20 (ab186725, abcam) and rabbit anti-ZO-1 (61-7300, Invitrogen). After brief rinses, the mounts were incubated with corresponding secondary antibodies (Invitrogen) for 1 h at room temperature. The mounts were washed and used for confocal microscopy investigation.

Statistical analysis

Data are presented as the mean ± standard deviations of at least three independent experiments. Statistical analyses were performed with SPSS (version 17; IBM, Armonk, NY, USA). Statistical significance was evaluated by Student’s t test, one-way ANOVA or two-way ANOVA, followed by Dunnett's multiple comparisons test. Differences were considered statistically significant at P < 0.05.