Patients
Peripheral blood (PB) or synovial fluid (SF) from eight ACPA-positive RA patients was collected at the outpatient clinic of the Department of Rheumatology at Leiden University Medical Center (LUMC). All RA patients met the 2010 American College of Rheumatology/European League against Rheumatism (ACR/EULAR) criteria for RA at the time of diagnosis. Treatment regimens included csDMARDs, glucocorticoids, and biologic agents. Permission for conduct of the study was given by the ethical review board of LUMC. All donors gave written informed consent. All included patients were determined to be EBV-seropositive by the presence of anti-EBV nuclear antigen (EBNA)-IgG and anti-viral capsid antigen (VCA)-IgG antibodies in their plasma (Table 1).
Table 1 Patient characteristics. Values of the most recent CCP2-IgG plasma titer, EBNA-IgG plasma titer, and VCA-IgG plasma titer were determined by diagnostic testing. Of patients one to seven, PB was analyzed and depicted in Figs. 1A–C and 2D. From patient eight, we analyzed SF and the results are depicted in Supplementary Fig. 2. Disease activity was assessed by routine clinical assessment of 28 joints for pain and swelling and subsequent calculation of the DAS28(3v)-ESRAntigen labeling
Allophycocyanin (APC) or Brilliant Violet 605 (BV605)-labeled streptavidins were conjugated to a biotinylated cyclic citrullinated peptide (CCP)2 and the arginine-control variant CArgP2 was conjugated to phycoerythrin (PE)-labeled extravidin, as described previously [8]. Optimal concentrations of these tetramers for identifying citrullinated antigen-specific B cells were determined by titrations on Ramos 3F3 and Ramos MDL-AID KO cell lines [9].
ACPA-B cell isolation, culture, and DNA isolation
PBMCs and SFMCs were isolated by Ficoll-Paque gradient centrifugation. SF was treated with hyaluronidase (Sigma-Aldrich) before subjection to Ficoll-Paque. Isolated cells were stained with Live/dead Fixable Violet dead cell-stain kit 451 nm (life technologies), CD3-PB (UCHT1, BD), CD14-PB (M5E2, BD), CD19-APC-Cy7 (Sj25C1, BD), CD20-AF700 (2H7, BioLegend), CD27-PE-Cy7 (M-T271, BD), IgG-BV510 (G18-145, BD), IgD-FITC (IA6-2, BD), CCP2-BV605, CCP2-APC, and CArgP2-PE. Pools of ACPA-expressing B cells (dead cell-staining negative, CD3−, CD14−, CD19+, CCP2+/+, CArgP2−) were isolated using a FACS Aria III 4L (BD Biosciences) cell sorter at the Flow Cytometry Core Facility of the LUMC. In total, 296 ACPA-expressing B cells were isolated and divided over 16 pools containing 10–20 cells each. As the majority of ACPA-expressing B cells have a CD20+ CD27+ memory phenotype [8], equal pools of IgG+ memory B cells not expressing ACPA (dead cell-staining negative, CD3−, CD14−, CD19+, CD20+, CD27+, IgG+, IgD−, CCP2−/−) were isolated as controls (Supplementary Fig. 1). PB cells were isolated in a flat-bottom 96-well culture plate containing 10,000 cells/well irradiated mouse fibroblast cells expressing human CD40 ligand (CD40L) in complex B cell-culture medium (IMDM, 8% FCS, 100 U/ml penicillin/streptomycin, 1 ng/ml IL-1β, 500 ng/ml R848, 50 ng/ml IL-21, 0.3 ng/ml TNF-α, 20 μg/ml IgG-depleted apotransferrin, 50 μM β-mercaptoethanol). Cells were kept in culture for 11–12 days at 37°C/5% CO2. Thereafter, supernatants were tested in ELISA. Cell pellets were resuspended in 45 μl of PicoPure™ proteinase K buffer (ThermoFisher) and transferred to a 96-well PCR plate. SF cells were isolated and lysed directly without culture. For DNA isolation, 96-well PCR plates containing cells in proteinase K buffer were incubated at 65°C for 3 hours, followed by 95°C for 15 min, and stored at −20°C until further use.
JY cells were obtained from ATCC and cultured in IMDM containing 8% FCS, 100U/ml penicillin/streptomycin, and 2mM GlutaMax.
CCP2-Ig and total-Ig ELISAs
The presence of CCP2-Ig, CArgP2-Ig, and total-Ig in culture supernatants was assessed by ELISA. For the CCP2 and CArgP2 ELISA, C96 Maxisorp Nunc Immuno plates (Thermo Fisher Scientific) were coated with streptavidin, to which biotinylated CCP2 or CArgP2 peptide was added. For total-Ig, 96 well plates were coated with goat anti-human IgG + IgM + IgA heavy and light chain (Bethyl) capture antibodies followed by a blocking step with PBS/1%BSA/50mM Tris, pH 8.0. For all three ELISAs, samples were tested in a 1:2 or 1:5 dilution. CCP2-Ig, CArgP2-Ig, or total-Ig was detected by HRP-conjugated polyclonal goat anti-human IgG+IgM+IgA heavy and light chain antibodies (Bethyl). Absorbance was measured at 415 nm using ABTS + H2O2 (Sigma-Aldrich) on an iMark™ Microplate Absorbance Reader (Bio-Rad).
Probe-based qPCRs
Proteinase K isolated DNA from individual B cell pools was subjected to qPCR using BNRF1 and Beta-2-Microglobulin (B2M)-specific primers in order to determine the presence or absence of EBV DNA and human DNA, respectively. qPCR reactions were performed in duplicates using 2.5 times diluted DNA, Hot StarTaq Master Mix Kit (Qiagen), 300nM forward and reverse primers, and 250nM probe. B2M forward: 5′-GGATAGGTGAGGACTATC-3′. B2M reverse: 5′-CCTGTGGATGCTAATTAAA-3′'. B2M probe: 5′-/5Cy5/AAGTATGTTCTGTCCCATTTGC/3IAbRQSp/-3′. BNRF1 forward: 5′-GGAACCTGGTCATCCTTTGC-3′. BNRF1 reverse: 5′-ACGTGCATGGACCGGTTAAT-3′. BNRF1 probe: 5′-/56-FAM/CGCAGGCACTCGTACTGCTCGCT/3BHQ_1/-3′. Negative controls included H2O and CD40L L cells only from the isolation and culture procedure. Positive controls included the standard curve generated from JY cell DNA and wells containing DNA from either 1, 2, 5, 10, 20, 50, or 100 JY cells. qPCR protocol: 15′ 95°C, 40 times 5″ 95°C 15″ 55°C (camera), 15″ 72°C.
留言 (0)