Mice

OT-I TCR transgenic mice, Cas9-EGFP-expressing Gt (ROSA) 26Sortm1.1(CAG-cas9*,-EGFP) Fezh41, Slp76OST (B6-Lcp2tm2Mal), Zap70OST (B6- Zap70tm5Mal) and Cd3ζOST (B6-Cd247Tm1Ciphe) mice were maintained in specific pathogen-free conditions at the Centre d’ImmunoPhénomique (agreement B1301407) or the Centre d’Immunologie de Marseille-Luminy (agreement F13005), and all experiments were done in accordance with national and international guidelines for laboratory animal welfare and experimentation (EEC Council Directive 2010/63/EU, September 2010). For all experiments and strains, mice were sex matched and of 8–10 weeks of age. Slp76OST (B6-Lcp2tm2Mal) and Zap70OST (B6- Zap70tm5Mal) mice are described in Roncagalli et al.19. For the Cd3ζOST (B6-Cd247Tm1Ciphe) mouse, the generic approach already described in Voisinne et al.22 was used to construct the targeting vector permitting to introduce a Twin-Strep-tag-coding sequence (OST42) at the 3′ end of Cd3ζ. Screening for the presence of the OST-targeted allele was performed by PCR using the pair of primers: 5′-GGTCTCAGCACTGCCACCAA-3′ and 5′-GGCAAGTGAGAGAACCATCC-3′. This pair of primers amplified a 196-bp band for the WT allele and a 377-bp band for the OST-targeted allele.

Flow cytometry

Stained cells were analyzed using an LSRII system (BD Biosciences). Data were analyzed with the Diva software v.8 (BD Biosciences) and FlowJo v.10. Cell viability was evaluated using SYTOX Blue (Life Technologies). The following antibodies were used: anti-CD5 (BD Biosciences, catalog no. 550035, clone 53–7.3, DF 1:800), anti-CD4 (BD Biosciences, catalog no. 557956, clone RM4-5, DF 1:800), anti-CD8α (BD Biosciences, catalog no. 563046, clone 53–6.7, DF 1:400), anti-TCRβ (BD Biosciences, catalog no. 562839, clone H57-597, DF 1:200), anti-CD44 (BD Biosciences, catalog no. 560569, clone IM7, DF 1:800), anti-CD69 (BD Biosciences, catalog no. 553236, clone H1.2F3, DF 1:400), anti-CD6 (BD Biosciences, catalog no. 566426, clone J90-462, DF 1:800), anti-CD3ε (Biolegend, catalog no. B209683, clone 145-2C11, DF 1:200) and the anti-IFN-γ (Biolegend, catalog no. 505826, clone XMG1.2, DF 1:600).

T cell isolation and short-term expansion

OT-I CD8+ T cells were purified from pooled lymph nodes and spleens with a Dynabeads Untouched Mouse CD8+T Cell Kit (Life Technologies); cell purity was 95%. CD8+ purified T cells were expanded for 48 h with plate-bound anti-CD3 (145-2C11, 5 μg ml–1) and soluble anti-CD28 (37-51; 1 μg ml–1 both from EXBIO). Then, T cells were harvested and grown in the presence of IL-2 (5–10 U ml–1) for 48 h before stimulation for phosphoproteomic and interactomic analysis.

T cell proliferation and IFN-γ production

For proliferation assay, OT-I CD8+ T cells were stimulated with 20, 50 or 300 nM of N4, T4 or G4 tetramers, respectively (provided by the National Institutes of Health (NIH) tetramer core facility), with soluble anti-CD28 (37-51; EXBIO) antibody. After 48 h of culture, T cell proliferation was assessed by CTV dilution. For IFN-γ production, cells were stimulated with the same conditions and treated with GolgiStop (BD Biosciences) for the last 4 h. After incubation, cells were washed and stained for dead cells, permeabilized (fixation/permeabilization buffer; Cytofix/CytoPerm BD Biosciences) and stained for intracellular IFN-γ (XMG1.2; BioLegend) before analysis by flow cytometry.

Deletion of the Cd6 gene in primary OT-I CD8+ T cells

OT-I CD8+ T cells were purified by immunomagnetic negative selection from mice constitutively expressing Cas9 and edited as previously described13. The Cd6 gene was ablated using the following sgRNAs (sg-1 Cd6: CCAAGGAAGAGCCACAUGUC, sg-2 Cd6: UCAGCAAUCCAGCGAUCCCA). The Ubash3a/b genes were ablated using the following sgRNAs (sgUBASH3A(1): UUUCCAGCAAGGGGCCCGUG, sgUBASH3A(2): UUUUCCAGCAAGGGGCCCGU, sgUBASH3B(1): UGCAGACUACUGUCAGUCGA sgUBASH3B(2): CUUCAUCGGGCUCUUCGUGA). T cells from Cas9-expressing mice also express EGFP and were used as control with the following sgRNA: GGGCGAGGAGCUGUUCACCG. The efficiency of gene deletion was checked by flow cytometry on day 3 after transfection. Edited cells were kept in culture in the presence of IL-2 (10 U ml–1) and IL-7 (5 ng ml–1) for 3 days after nucleofection. Cells were then restimulated with N4, T4 or G4 tetramers and IFN-γ production was assessed by intracellular fluorescence-activated cell sorting 24 h later.

Stimulation of T cells for phosphoproteomic analysis

A total of 20 × 106 short-term expanded OT-I CD8+ T cells were left unstimulated or stimulated at 37 °C with 20, 50 or 300 nM of N4, T4 or G4 tetramers, respectively. Stimulation was stopped after 30, 120, 300 or 600 s by snapfreezing the cells in liquid nitrogen. A total of six replicates were prepared for unstimulated and each time point of N4-stimulated samples, and three replicates for T4- and G4-stimulated samples.

Phosphopeptide enrichment

The frozen cell pellets (final volume of 100 μl) were thawed and all steps until peptide digestion were performed on ice. Each pellet was resuspended in 303 μl of urea 8 M, Tris/HCl 100 mM pH 8 supplemented with PhosSTOP phosphatase inhibitor cocktail (catalog no. 04906845001, Roche), cOmplete ULTRA tablets, mini, EDTA-free (catalog no. 04693132001, Roche) and sodium orthovanadate (catalog no. S6508-10G, Sigma) 1 mM final concentration. Lysis was performed with a Bioruptor (position high, 15 cycles of 50 s/40 s) before centrifugation for 30 min (11,860g) at 4 °C. The protein quantity in the supernatant was measured using Bio-Rad DC protein assay kit 2 (catalog no. 500-0112-MSDS) before being kept at −80 °C until digestion. Each protein sample was subjected to filter-aided sample preparation43. Briefly, 1 mg of proteins per sample was concentrated with filter units (Sartorius Vivacon 500, 10 or 30 molecular weight cutoffs). Cysteine residues were reduced with 10 mM final of dithiothreitol for 40 min at 20 °C, alkylated with iodoacetamide at a final concentration of 50 mM for 25 min in the dark at room temperature. The urea concentration was then reduced by buffer exchange and the filter units were washed three times with 100 μl of triethylammonium bicarbonate (TEAB) 100 mM. Digestion was performed using trypsin (catalog no. V5117, Promega) 1% (trypsin/protein) overnight at 37˚C. Peptides were eluted from the filters by three successive centrifugation steps (one elution and two TEAB washes) before being dried down. Each peptide sample was resuspended in 500 μl of TEAB 100 mM and sonicated for complete resuspension. Next, 400 μg of peptides were independently labelled with 1.6 mg of a given TMT10 Label Reagent (TMT10plex Mass Tag Labeling Kit, catalog no. 90111, Thermo Scientific) for 1 h at room temperature. Free regents were then quenched using hydroxylamine 5% final and labelled peptides were combined (ten samples per mix: total of 4 mg of peptides), according to the multiplexing design depicted in Extended Data Fig. 1, resulting in six different TMT batches. For each batch, an aliquot of 5 μg was analyzed by MS for nonmodified peptides and protein relative quantification, and the remainder was further processed for phosphopeptide purification. All phosphopeptide enrichments were performed with Titansphere TiO2 beads (5 μm; GL Sciences. catalog no. 5020 75000) prewashed in TiO2 loading buffer (80% acetonitrile, 5% trifluoroacetic acid (TFA), 1 M glycolic acid). For each enrichment, the peptides were resuspended in TiO2 loading buffer (1 μg μl–1) and sonicated for 10 min before incubation with TiO2 beads 6:1 (w:w) beads:peptide for 15 min under agitation at room temperature. Beads were then sequentially washed with (1) loading buffer; (2) 80% acetonitrile, 1% TFA and (3) 10% acetonitrile, 0.2% TFA. Phosphopeptides were eluted twice with 50 μl of 1% ammonium hydroxide (pH 11.3), pooled and acidified with TFA. The eluates were then cleaned up using R3 resin packed in home-made microtips, equilibrated with 0.1% TFA. Samples were washed with 0.1% TFA and eluted with 0.1% TFA 80% acetonitrile before drying down under vacuum. The phospho-enriched peptides were further subjected to pY-IP using the PTMScan Phospho-Tyrosine Rabbit mAb (P-Tyr-1000) Kit (catalog no. 8803, Cell Signaling Technology, Ozyme) according to the manufacturer’s instructions. Briefly, phosphopeptides were resuspended on ice in cold IAP buffer (14 mg ml–1), sonicated for complete resuspension, and incubated with prewashed PTMScan beads (80 μl of P-Tyr bead slurry for 20 mg of protein starting material) for incubation overnight at 4 °C under mild agitation. Then, the beads were sequentially washed with IAP buffer (50 mM MOPS/NaOH, 10 mM Na2HPO4, 50 mM NaCl pH 7.2–7.4) and water before elution of the phosphopeptides with 0.15% TFA at room temperature for 10 min. Phosphotyrosine-containing peptides were then dried down under vacuum before MS analysis for phosphotyrosine relative quantification whereas the flow-throughs were analyzed for phosphoserine and phosphothreonine relative quantification.

MS runs and search for phosphoproteomics

Samples were resuspended in 20 µl of 2% acetonitrile, 0.05% TFA, and analyzed by nanoliquid chromatography (LC) coupled to tandem MS, using an UltiMate 3000 system (NCS-3500RS Nano/Cap System, Thermo Scientific) coupled to an Orbitrap Fusion Tribrid (Thermo Scientific). Peptide samples (6 µl) were loaded and desalted on a C18 trap column (300 µm inner diameter × 5 mm, Thermo Scientific), then peptide separation was performed on an analytical C18 column (75 µm inner diameter × 50 cm, inhouse packed with Reprosil C18) equilibrated in 95% solvent A (5% acetonitrile, 0.2% formic acid) and 5% solvent B (80% acetonitrile, 0.2% formic acid), using a multi-step linear gradient of solvent B over a total of 240 min (total peptides and TiO2 enriched phosphopeptides) or 160 min (pY-IP enriched phosphopeptides). The fusion was operated in data dependent acquisition mode using a synchronous precursor scan-MS3 method, to avoid distortion of the ratio obtained from the TMT reporter signal when interfering peptides are co-isolated for MS2. Survey scans were performed in the Orbitrap mass analyzer at 120,000 resolution, selected parent ions were first isolated by the instrument’s quadrupole and MS2 scans were acquired in the linear ion trap using collision-induced dissociation (normalized collision energy = 35). For TMT reporter detection, MS3 scans were recorded in the Orbitrap at 60,000 resolution, following selection of the top ten precursor fragments by synchronous precursor scan and fragmentation by higher-energy collisional dissociation (normalized collision energy = 65), with an automatic gain control (AGC) target of 1 × 105 and a maximum injection time of 120 ms. Dynamic exclusion was set at 20 or 30 s for pY- or TiO2-enriched samples, respectively. Inclusion lists were generated based on the phosphorylation sites regulated in a minimum of one condition from the analysis of the OT1 samples N4–T4. This led to the inclusion of 62 masses for the pY-IP and 610 for the TiO2 for the N4–G4 runs.

Raw files were analyzed with Proteome Discoverer v.2.2.0.388 using Mascot with the following parameters: Trypsin/P; maximum three missed cleavages; fragment mass tolerance 0.6 Da; precursor mass tolerance 10 ppm; fixed modification carbamidomethyl (C) and dynamic modifications phospho (ST) and (Y), oxidation (M), deamidated (NQ), acetyl (N-term); quantification method TMT10plex; target FDR was calculated using Percolator with strict of 0.01 and relaxed of 0.05 (based on Q value); ptmRS was used for phosphorylation site localization. Data were searched against Mus musculus entries of the UniProt KB protein database (release Swiss-Prot v.2017_01, 16,844 entries).

Processing and statistical analysis of phosphorylation data

The statistical analysis was performed using the statistical package R (R Development Core Team, 2012; http://www.r-project.org/). Each TMT channel was corrected for mixing errors using the signal from nonphosphorylated samples. Only the phospho-sites with a localization score ≥75% in a minimum of one replicate were kept, and the phosphoserines and phosphothreonines were removed from the phosphotyrosine IP samples. Conversely, the phosphotyrosines quantified in the pY-IP were removed from the TiO2 dataset. Phosphosite intensities were log2-transformed and averaged across technical replicates. At this stage, missing values were replaced as follows: if for a given condition (time point, tetramer), a phosphorylation site was not quantified in any replicate experiment, missing values for that condition were imputed with low-intensity values drawn from a Gaussian distribution with mean and s.d. respectively equal to the 5% quantile and the s.d. of the entire dataset. Phosphorylation intensities were then normalized between experiments using the average intensity from N4-stimulated and unstimulated conditions—experimental conditions that were shared across all experiments.

For statistical analysis, phospho-sites with high numbers of missing values were not considered: for a given ligand affinity (tetramer), only phosphorylation sites that were detected in at least three conditions (time points) and presenting in each of them a minimum of two quantification values from the same independent replicate experiments, were retained. For those, an ANOVA test with Tukey correction was conducted to identify TCR-regulated phospho-sites. Phospho-sites were considered as significantly regulated if they presented a P value of the ANOVA ≤ 0.05 and a minimum of one couple of time points with a corrected P value ≤ 0.05 and an associated absolute fold change of greater than 1.5.

Stimulation of T cells and preparation of samples for interactomic analysis

A total of 100 × 106 short-term expanded OT-I CD8+ T cells were left unstimulated or stimulated at 37 °C with 20, 50 or 300 nM of N4, T4 or G4 tetramers respectively. Stimulation was stopped by the addition of a twice-concentrated lysis buffer (100 mM Tris, pH 7.5, 270 mM NaCl, 1 mM EDTA, 20% glycerol, 0.4% n-dodecyl-β-d-maltoside) supplemented with protease and phosphatase inhibitors. After 10 min of incubation on ice, cell lysates were centrifuged at 21,000g for 5 min at 4 °C. Postnuclear lysates were then used for AP. Equal amount of postnuclear lysates were incubated with Strep-Tactin Sepharose beads (IBA GmbH) for 1.5 h at 4 °C on a rotary wheel. Beads were then washed five times with 1 ml of lysis buffer in the absence of detergent and of protease and phosphatase inhibitors. Proteins were eluted from the Strep-Tactin Sepharose beads with 2.5 mM d-biotin—a ligand that binds to Strep-Tactin with a higher affinity than the OST sequence. Protein samples were processed for proteomic analysis either by short migration on SDS–polyacrylamide gel electrophoresis (one band) and in-gel trypsin digestion, or through protein capture on paramagnetic hydrophilic beads44 and in-solution trypsin digestion.

MS runs and search for interactomics

Tryptic peptides were resuspended in 17 µl of 2% acetonitrile, 0.05% TFA and analyzed on an Orbitrap Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific). Peptides were separated with the same chromatographic set-up as described above, with a 60-min or 105-min-long gradient of solvent B depending on the analytical series. The MS was operated in data-dependent acquisition mode with the Xcalibur software. MS survey scans were acquired with a resolution of 70,000 and an AGC target of 3 × 106. The ten most intense ions were selected for fragmentation by high-energy collision-induced dissociation, and the resulting fragments were analyzed at a resolution of 17,500, using an AGC target of 1 × 105 and a maximum fill time of 50 ms. Dynamic exclusion was used within 30 s to prevent repetitive selection of the same peptide.

Raw MS files were processed with MaxQuant software (v.1.5.2.8) for database search with the Andromeda search engine and quantitative analysis. Data were searched against M. musculus entries of the UniProt KB protein database (release UniProtKB/Swiss-Prot+TrEMBL 2017_01, 89,297 entries including isoforms), plus the One-Strep-tag peptide sequence, and the set of common contaminants provided by MaxQuant. Carbamidomethylation of cysteines was set as a fixed modification, whereas oxidation of methionine, protein N-terminal acetylation, and phosphorylation of serine, threonine and tyrosine were set as variable modifications. Specificity of trypsin digestion was set for cleavage after K or R, and two missed trypsin cleavage sites were allowed. The precursor mass tolerance was set to 20 ppm for the first search and 4.5 ppm for the main Andromeda database search. The mass tolerance in tandem MS mode was set to 0.5 Da. Minimum peptide length was set to seven amino acids, and minimum number of unique or razor peptides was set to one for validation. The I = L option of MaxQuant was enabled to avoid erroneous assignation of undistinguishable peptides belonging to very homologous proteins. Andromeda results were validated by the target decoy approach using a reverse database, with an FDR set at 1% at both peptide spectrum match and protein level. For label-free relative quantification of the samples, the match between runs option of MaxQuant was enabled with a match time window of 1 min, to allow cross-assignment of MS features detected in the different runs, after alignment of the runs with a time window of 20 min. Protein quantification was based on unique and razor peptides. The minimum ratio count was set to one for label-free quantification calculation, and computation of the iBAQ metric was also enabled.

Data processing and identification of specific interactors

From the ‘proteinGroups.txt’ files generated by MaxQuant with the options described above, protein groups with negative identification scores were filtered out as well as proteins identified as contaminants. In situations where protein groups corresponded to the same gene name, protein intensities in a given sample were summed over the redundant protein groups. Protein intensities were normalized across all samples by the median intensity. Normalized intensities corresponding to different technical replicates were averaged (geometric mean) and missing values were replaced after estimating background binding from WT intensities. For each bait and each condition of stimulation, we used a two-tailed Welch t-test to compare normalized log-transformed protein intensities detected in OST-tagged samples across all biological replicates to WT intensities pooled from all conditions of stimulation. To avoid spurious identification of interactors due to missing value imputation, we repeated this process (missing value imputation followed by a two-tailed Welch t-test) ten times and estimated fold changes and P values as their respective average (geometric mean) across all ten tests. Log-transformed fold changes and corresponding P values were used to generate a volcano plot representing interactions across all conditions of stimulation. Asymmetry of this volcano plot was used to compute the interaction FDR as described previously22,45. Specific interactors were identified as preys showing a greater than tenfold enrichment with an FDR below 0.05 in at least one condition of stimulation.

Analysis of the whole proteome of OT-I cells

For proteome analysis, OT-I cell pellets (five biological replicates) were incubated with 150 μl of lysis buffer containing Tris 50 mM, pH 7.5, EDTA 0.5 mM, NaCl 135 mM, SDS 1%, boiled 5 min at 95 °C and sonicated on a Bioruptor (Diagenode). Protein concentration was determined using a detergent compatible assay (DC assay, Bio-Rad) and an aliquot of 150 µg of protein extract was reduced (TCEP 10 mM) and alkylated (Chloroacetamide 40 mM) for 15 min at 45 °C, and digested with trypsin on a S-trap Mini device (Protifi) according to the manufacturer’s protocol. The resulting peptides were further fractionated (Pierce High pH Reversed-Phase Peptide Fractionation Kit, catalog no. 84868) into eight fractions. Each of them was dried, resuspended in 17 µl of 2% acetonitrile, 0.05% TFA and an aliquot (5 µl) was analyzed on an Orbitrap Q-Exactive HFX mass spectrometer (Thermo Fisher Scientific). Peptides were separated with a 60-min-long gradient of solvent B on an Acclaim PepMap C18 column (75 µm inner diameter × 50 cm, 2 µM particles, catalog no. 164942, Thermo Fisher Scientific). The MS was operated in data-dependent acquisition mode with the Xcalibur software. MS survey scans were acquired in the Orbitrap with a resolution of 60,000 and an AGC target of 3 × 106. The 12 most intense ions were selected for fragmentation by high-energy collision-induced dissociation, and the resulting fragments were analyzed at a resolution of 30,000, using an AGC target of 1 × 105 and a maximum fill time of 54 ms. Dynamic exclusion was used within 30 s to prevent repetitive selection of the same peptide. Raw MS files were processed with MaxQuant with the same parameters as described for affinity-purified samples, except that phosphorylation was not included as variable modification. Protein entries from the MaxQuant ‘proteinGroups.txt’ output were first filtered to eliminate entries from reverse and contaminant databases. Cellular protein abundances were determined from raw intensities using the protein ruler methodology46, using the following relationship: protein copies per cell = (protein MS signal × NA × mDNA)/(M × histone MS signal), where NA is Avogadro’s constant, M is the molar mass of the protein and mDNA is the DNA mass of a diploid mouse cell estimated to be 5.5209 pg. Cellular protein abundances were averaged (geometric mean) over biological replicates. Overall, the cellular protein abundance could be estimated for 4,988 protein groups.

Western blot and antibodies

For biochemistry analysis, OT-I CD8+ T cells were stimulated for indicated times at 37 °C with 20 nM of N4, 50 nM of T4 or 300 nM of G4 tetramers. Stimulation was stopped by the addition of a twice-concentrated lysis buffer (100 mM Tris, pH 7.5, 270 mM NaCl, 1 mM EDTA, 20% glycerol, 0.4% n-dodecyl-β-maltoside) supplemented with protease and phosphatase inhibitors. After 10 min of incubation on ice, cell lysates were centrifuged at 21,000g for 5 min at 4 °C. Postnuclear lysates were used for whole cell lysates for subsequent immunoblot analysis. The following antibodies were used for immunoblot analysis: anti-SLP76 (Cell Signaling Technology, catalog no. 4958), anti-ZAP70 (Cell Signaling Technology, catalog no. 2705, clone 99F2), anti-ZAP70-pY318 (Cell Signaling Technology, catalog no. 2701), anti-ZAP70-pY492 (Cell Signaling Technology, catalog no. 2704), anti-4E-BP1-pT37/T45 (Cell Signaling Technology, catalog no. 2855, clone 234B4), anti-PLCγ1-pY783 (Cell Signaling Technology, catalog no. 2821), anti-PLCγ1 (Cell Signaling Technology, catalog no. 2822), anti-LAT-pY220 (Cell Signaling Technology, catalog no. 20172, clone E3S5L), anti-LAT-pY255 (Cell Signaling Technology, catalog no. 45170), anti-ERK1/2-pY204/T202 (Cell Signaling Technology, catalog no. 9106, clone E10), anti-ERK1/2 (Cell Signaling Technology, catalog no. 9102), anti-FOXO3-pS252 (Cell Signaling Technology, catalog no. 13129, clone D18H8), anti-FOXO3 (Cell Signaling Technology, catalog no. 12829, clone D19A7), anti-SHC1-pY317/423 (Cell Signaling Technology, catalog no. 2431), anti-RPS6-pS235/ 236 (Cell Signaling Technology, cat 4858, clone D57.2.2E), anti-P70S6K-pT389 (Cell Signaling Technology, catalog no. 9206, clone 9206), anti-p90RSK1-S369 (Cell Signaling Technology, catalog no. 12032, clone D5D8), phospho-AKT substrates (Cell Signaling Technology, catalog no. 9611), anti-ZAP70-Y290 (Biolegend, catalog no. 691902, clone A16038A), anti-PDCD4- pS457 (Thermo Fisher, catalog no. PA5-38806), anti-LAT-pY132 (Thermo Fisher, catalog no. 44-224), anti-CD6 from (Novus Biologicals, catalog no. MAB727, clone 96123) and global anti-pY (Millipore, catalog no. 16-105, clone 4G10). All residue numbering is based on the mouse protein sequences.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.