Total 38 cases samples (17 cases of RCC and 21 cases of normal kidney tissue) were collected from The People’s Hospital of Guangxi Zhuang Autonomous Region. Informed consent was obtained from all patients. The specimens embedded in paraffin were cut into sections, then slides were dewaxed with dimethylbenzene and rehydrated through grade alcohols. After the addition of citrate buffer for antigen retrieval under pressure, the slides were placed in 3% H2O2 for 15 min. Then the sample were incubated with primary antibodies against AKT1 (ab238477, Abcam, 1/1000) at 4 °C overnight. After washed with PBS, the slides were cultured in the secondary antibody at room temperature for 30 min. Then washed in PBS, slides were incubated with DAB for 5 min and counterstained with hematoxylin, dehydrated and mounted. The study was approved by the local Ethics Committee (The People’s Hospital of Guangxi Zhuang Autonomous Region). The research complies with the provisions of the Declaration of Helsinki (as revised in 2013).

The caki-2 cell lines were purchased form the Chinese Academy of Science (Shanghai, China). The cells were propagated in McCoy’s 5a medium supplemented with 10% fetal bovine serum (E510002, Sangon Biotech) containing penicillin–streptomycin solution (100×) (P1400, Solarbio, China) at incubator with 37 °C with 5% CO2. Finally, cells exhibiting good growth at the logarithmic growth phase were selected for transfection.

According to the AKT sequence information in NCBI, 3 interference sequences were constructed (Table 1) by Sangon Biotech (shanghai) Co., Ltd. Caki-2 cells were collected and seeded into a 6-well culture plates and then assigned into 5 groups respectively: control group, negative control (NC) group (transfected with empty plasmid negative control), siAKT-1 group (transfected with AKT-siRNA-1), siAKT-2 group (transfected with AKT-siRNA-2), siAKT-3 group (transfected with AKT-siRNA-3). Prior to cell transfection, the cells exhibiting good growth condition were seeded in a 6-well plate at the density of 5 × 105 cells. When cell coverage rate reached 70%, the cells were transfected with the medium replaced with a serum-and -antibiotic-free medium. 125 ul Opti-MEN (31985-062, Gibco) was added to two EP tube, 5 ul Lipofectamine 3000 (L3000015, Invitrogen) was added to one tube and 0.25 nmol siRNA was added to the other tube, and two tubes were incubated at room temperature for 5 min after mixed. Then the two EP tubes were mixed and incubated at room temperature for 15 min. The mixed liquid was dropped into the corresponding well in the 6-well plate, and cells was put back into the incubator for culture. After 4–6 h of transfection, 1 ml of complete medium containing 20% serum was added into the 6-well plate. At 48 h after transfection, the cells were collected for subsequent experiments.

Total RNA was extracted using ultrapure RNA Extraction Kit (CW0581M, CWBIO). Total RNA was reversely transcribed to cDNA using HiScript II Q RT SuperMix for qPCR (+ gDNA wiper) (R223-01, Vazyme). PCR was performed by using 2 × SYBR Green PCR Master Mix (A4004M, Lifeint). The reaction conditions were as follows: pre-denaturation at 95 °C for 10 min and 40 cycles of denaturation at 95 °C for 10 s, annealing at 58 °C for 30 s, and extending at 72 °C for 30 s. Data were analyzed using the ana2−ΔΔCT method. The primer sequences for AKT were as follows: AKT sense, forward 5′GCTATTGTGAAGGAGGGTTGG3′ and reverse 5′ACAGTCTGGATGGCGGTTG3′. β-actin sense, forward 5′TGGCACCCAGCACAATGAA′ and reverse 5′CTAAGTCATAGTCCGCCTAGAAGCA3′.

Caki-2 cells transfected with siRNA were lysed with protein lysate RIPA (C1053, Applygen Technologies INC.). After centrifugation for 10 min at 12,000 r/min, the supernatant was collected, and the total protein concentration was determined with the BCA protein assay kit (CW0014S, CWBIO) and preserved at − 20 °C. Then total protein was loaded to 10% sodium dodecyl sulfate (151-21-3, XiLong Scientific)-polyacrylamide gel electrophoresis (A1010, Solarbio) (SDS-PAGE). Finally transfer to a polyvinylidene fluoride (PVDF) (IPVH00010, Millipore) membrane at constant pressure of 60 V was performed. Membrane blockade was conducted with 5% skim milk powder and then incubated with a primary antibody for overnight reaction at 4 °C. After washing, the membrane was incubated for 2 h at room temperature with horseradish peroxidase (HRP)-conjugated secondary antibodies. The super sensitive enhanced chemiluminescence (ECL) enlight-plus (RJ239676, Thermo Fisher scientific) reaction solution was applied for developing purposes. Then images were acquired using a Chemi DocTM XRS+ imaging system (Bio-Rad). The information of antibodies was listed as follow: Internal control primary antibody: Mouse Monoclonal Anti-GAPDH (TA-08, ZSGB-BIO, 1/2000), secondary antibody: HRP-labeled goat anti-mouse IgG (H + L) (ZB-2305, ZSGB-BIO, 1/2000), purpose primary antibody: Rabbit Anti AKT (ab8805, Abcam, 1/500), secondary antibody: HRP-labeled goat anti-rabbit IgG (H + L) (ZB-2301, ZSGB-BIO, 1/2000).

After transfection, cells were seeded into 96-well plates at a density of 7 × 103cells/well and cultured for 24 h. Then 10 μl of CCK8 solution (KGA317, KEYGEN) was added directly to each well and incubated for 2 h at 37 °C. The absorbance was measured at 450 nm.

Matrigel (BD, USA) was selected for transwell assay. The medium in the well was removed, then stained with 0.1% crystal violet (G1061, Solarbio) for 1 h after washed by PBS for 5 min. Cells in the inner compartment were scraped off by a moist cotton swab, then chamber inverted on slide was photographed. Then 1 ml of 33% acetic acid was added in every well to dissolved staining fluid in cells after crystal violet was removed, and 200 μl of cell suspension was added to 96-well plates. The optical density value (OD value) at 570 nm was measured using a multi-scan spectrum (S/N502000011, TECAN).

Parallel lines at 0.5 cm intervals was marked at the back of 6-well plate, then cells were evenly inoculated into the 6-well plate. When cell coverage rate reached 90%, wounds were created using 200 μl pipette tip. After washed three times by PBS the cells were incubated with a serum-free medium at 37 °C in a 5% CO2 incubator. The cells were photographed at the 0 h and 48 h time points.

After transfection for 48 h, the cells (1 × 106–3 × 106) were washed twice with PBS and centrifuged at 1500 rpm for 3 min, and re-suspended in cold 1× binding buffer (300 μl). Then 3 μl of Annexin-V-FITC and 5 μl of PI (AP101-100-kit, MULTI SCIENCES) were added to each tube. After staining for 10 min at room temperature, 200 μl of 1× binding buffer was added to each tube. The apoptosis was analyzed using a flow cytometer (NovoCyte 2060R, ACEA Biosciences Inc.).

After transfection for 48 h, the cell suspension was centrifuged at 1500 rpm for 3 min and supernatant was removed. The cells were then added in 1 ml of PBS and centrifuged at 1500 rpm for 3 min. Then 1 ml of DNA Staining solution and 10 μl of Permeabilization solution (CCS102, MULTI SCIENCES) were added to each tube, and the mixtures were oscillated for 10 s by vortex mixer (XH-C, Changzhou LANGYUE instruments Maunfacturing Co., Ltd.). Cell cycle was measured using a flow cytometer (NovoCyte 2060R, ACEA Biosciences Inc.).

All the statistical analyses were conducted using GraphPad Prism 6.0 and IBM SPSS 19.0 software. Data were presented as mean ± standard deviation (SD), and p < 0.05 was considered statistically significant.