Antibodies and reagents

Antibodies used are as follows: anti-STEAP3 (cat# sc-376327, 1:1000 dilution), anti-Axin (cat# sc-293190, 1:500 dilution), anti-p-GSK3β (Ser 9) (cat# sc-373800, 1:1000 dilution) and anti-GSK3β (cat# sc-9166, 1:1000 dilution) were purchased from Santa Cruz Biotechnology; anti-ZO-1 (cat# 8193, 1:1000 dilution), anti-E-cadherin (cat# 3195, 1:1000 dilution), anti-Vimentin (cat# 5741, 1:1000 dilution), anti-Claudin-1 (cat# 13995, 1:1000 dilution), anti-GAPDH (cat# 5174, 1:2000 dilution), anti-β-catenin (cat# 8480, 1:1000 dilution), anti-Histone H3 (cat# 4499, 1:1000 dilution), anti-Snail (cat# 3879, 1:1000 dilution), anti-Slug (cat# 9585, 1:1000 dilution) and anti-HIF-1α (cat# 36169, 1:1000 dilution) were purchased from Cell Signaling Technology; anti-m6A (cat# ab208577, 1:1000 dilution), anti-YTHDF1 (cat# ab252346, 1:1000 dilution), anti-YTHDF2 (cat# ab246514, 1:1000 dilution), anti-METTL3 (cat# ab195352, 1:1000 dilution), anti-METTL14 (cat# ab220030, 1:1000 dilution) were purchased from Abcam.

Regents used in this study: Dimethyloxalylglycine (DMOG, cat# S7483) and actinomycin D (Act D, cat# S8964) were obtained from Selleck; DMSO (cat# D2650), Crystal Violet (cat# C0775), MTT (cat# M2128), FeSO4 (cat# 215422) and CoCl2 (cat# 15862) were obtained from Millipore Sigma. DMOG, actinomycin D and CoCl2 were dissolved in DMSO; Crystal Violet, MTT and FeSO4 were dissolved in ddH2O.

Cell lines and cell culture

CRC cells (HCT116, RKO, DLD-1, LoVo, SW480, SW620, HT29), the nonmalignant human colon epithelial cell line NCM460 and HEK293T were obtained from ATCC and maintained in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% fetal bovine serum (BI), 100 U/mL penicillin, and 100 μg/mL streptomycin (Invitrogen).

Patient-derived organoid

The generation of patient-derived organoid was performed as previously described [34]. Briefly, CRC tissue from patients was minced into small fragments (1–3 mm3) pieces and digested by collagenase II and TrypLE Express Enzyme at 37 °C. The organoid was then embedded within Matrigel and cultured in 48-well plates supplemented with human complete feeding medium in a humidified incubator with 5% CO2 at 37 °C.

Establishment of stable knockdown and overexpressed CRC cells

Lentiviral vectors or target plasmid were co-transfected into HEK293T cells with packaging vectors. Lentivirus particles were harvested at 24 and 48 h after transfection to infect CRC cells. shRNA plasmids were synthesized, annealed and cloned into pLKO.1 vector. Stable overexpressed gene were generated by using the pCDH expression vectors.

The sequences of shRNA and overexpression primers were as follows: STEAP3-AS1 shRNA#1, F 5′-CCGGGCACCTTTAAACTGTCCTACACTCGAGTGTAGGACAGTTTAA AGGTGCTTTTTG-3′, R 5′-AATTCAAAAAGCACCTTTAAACTGTCCTACACTCGAG TGTAGGACAGTTTAAAGGTGC-3′; STEAP3-AS1 shRNA#2, F 5′-CCGGG CTGTTCCGTGGAGCCATTATCTCGAGATAATGGCTCCACGGAACAGCTTTTTG-3′, R 5′-AATTCAAAAAGCTGTTCCGTGGAGCCATTATCTCGAGATAATGGCTCCACGGAA CAGC-3′; STEAP3-AS1 overexpression primer, F 5′-GAATTCAGACCC AAACCCCAGAGTCAT-3′, R 5′-GGATCCAGAGATGGGACCTCCCTGTGT-3′.

Western blot

CRC cells were harvest after washing twice with cold PBS. The pellet was resuspended and incubated on ice in lysis buffer for 30 min, and then the lysate was obtained by centrifugation at 12000×g for 10 min. Proteins were separated by SDS-PAGE, transferred onto PVDF membranes, blocked in 5% nonfat milk and then blotted with specific antibodies.

RT-qPCR

Total RNA was extracted from tissues and cells using Trizol (Invitrogen, USA) and reverse transcribed to cDNA by using a Reverse Transcription Kit (Takara, Dalian, China). The RNA transcripts levels were analyzed using a Bio-rad CFX96 real-time PCR system (Biorad, USA) and normalized to GAPDH. Primers used in RT-qPCR were listed in Supplementary Table S1.

Cell growth and proliferation assays

Cell viability was detected by adding 5% MTT and incubation at 37 °C for 2 h at 0, 24, 48, 72 and 96 h. The absorbance of each well was measured at 570 nm. All experiments were performed in at least triplicate.

For colony formation assay, 500 cells were planted and maintained in each well of 24 well plates for 2 weeks. The medium was refreshed every 3 days. Colonies were fixed with 4% paraformaldehyde for 1 hour and then stained with 0.1% crystal violet for 30 min and washed with ddH2O. The colony numbers of each well were counted.

Transwell migration and invasion assays

Migration and invasion assays were performed using Transwell chamber system (Corning, USA). For migration assay, 5 × 104 cells were seeded in the upper chamber of an insert with 0.2 ml FBS-free starvation medium, and 0.6 ml culture media with 20% FBS were added outside the chamber in the wells of the plate. For invasion assays, the upper chamber of the insert was pre-coated with Matrigel (Millipore Sigma) before plating cells. After incubation for 48 h, cells were fixed with 4% paraformaldehyde for 1 hour and then stained with 0.1% crystal violet for 30 min. After rinsing with water and airing, migrating or invading cells were imaged and counted using a Leica DM2500 microscope.

Immunofluorescence

After seeding onto the glass cover slides (WHB scientific, cat# whb-24-cs) and leaving at 37 °C overnight, cells were fixed by 4% formaldehyde, and then permeabilized with 0.3% Triton X-100 and blocked with 5% BSA. After being incubated with indicated primary antibodies (1:100 dilution) at 4 °C overnight, slides were incubated with Alexa Fluor 488/594-conjugated secondary antibodies (1:200 dilution) for 1 hour at room temperature, followed by DAPI staining of the nuclei (Solarbio, cat# C0060, 1:4000 dilution) at room temperature for 10 minutes. Finally, images were captured using confocal laser scanning microscopy (Carl Zeiss Microimaging) in Pub-lab of West China School of Basic Medical Sciences & Forensic Medicine, Sichuan University.

Immunohistochemistry

Immunohistochemistry was performed following a standard protocol. Briefly, slides were deparaffinized with xylene and ethanol, and the endogenous peroxidase was blocked by 3% H2O2 for 10 minutes. After being incubated in retrieval buffer and boiled for 3.5 minutes, slides were washed with PBS for 3 times and blocked with 5% normal serum. Then the slides were incubated with primary antibody at 4 °C overnight followed by 60 minutes-treatment of MaxVision HRP solution (MXB Biotechnology, cat# 5020). After being stained with DAB Peroxidase Substrate (MXB Biotechnology, cat# 0031), the antigen levels were detected using EnVision Detection System (Agilent Technologies, K5007).

Co-immunoprecipitation (co-IP)

After being collected and washed 2 times with pre-cooled PBS, cells were lysed using 1 mL complete protease and phosphatase inhibitor added IP lysis buffer (100 mM NaCl, 20 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 0.1% NP-40) and incubated on ice for 30 min. After centrifugation at 12000 rpm at 4 °C for 10 min, 80 μL of the supernatant was transferred and mix with 5× lording buffer in a new tube as the control. The remaining supernatant was transferred to a new tube and incubated with 1 μg indicated antibody overnight at 4 °C. After being washed 3 times with IP lysis buffer, 30 μL of protein A/G agarose beads (GE Healthcare, cat# 17-0963-03) were added into the mixture, and rotated for another 2 h at 4 °C. The beads were washed using washing buffer (150 mM NaCl, 0.5 mM EDTA, 20 mM Tris-HCl, pH 7.4, 0.5% NP-40) for 3 times, and proteins were separated by SDS-PAGE loading buffer with 10 min incubation at 100 °C, followed by immunoblotting analysis.

In vivo orthotopic implantation and spleen injection model

Six to eight weeks old male BALB/c nu/nu mice were used. For orthotopic implantation, 1 × 107 PBS suspended cells was injected subcutaneously. Tumors were collected and sliced into 3 × 3 mm pieces for orthotopic implantation once their diameter reached 1 cm. After being anesthetized and laparotomized, CRC tissues were positioned in the wound and tied down using a suture. The intestines were then placed back followed by closing the peritoneum after sterilization. For the spleen injection model, 5 × 105 cells were injected into the spleen through an incision on the left side of abdomen. Mice were sacrificed at 6–8 weeks after implantation or injection to examine the lung and liver metastases. H&E staining was performed after tissues were fixed in 4% formaldehyde.

Zebrafish xenograft model

Tg (flk1:eGFP) zebrafishes were used to establish zebrafish xenograft model of human CRC. After being anesthetized with 0.04 mg/mL tricaine (Millipore Sigma), zebrafishes received a microinjection of 200 mCherry stably expressed CRC cells. The tumor cells-bearing zebrafishes were randomly divided into two groups after examination of mCherry fluorescent signal in the next day. Zebrafishes were maintained under normal oxygen or hypoxic conditions for a period of 3 days. Finally, the mCherry fluorescent signal was read to examine the distribution and metastasis of CRC cancer cells using a stereo microscope.

In situ hybridization (ISH)

In situ hybridization assays were performed to evaluate the STEAP3-AS1 levels in the CRC xenograft model. Sections were deparaffinized with xylene and ethanol, and the endogenous peroxidase was blocked by 3% H2O2 for 10 minutes at room temperature. After being incubated with 3% citric acid and freshly diluted pepsin for about 60 s at 37 °C, slides were washed 3 times with PBS and fixed with 1% formaldehyde with addition of 0.1% DEPC for 10 min at room temperature. The sections were then pre-hybridized at 40 °C for 2 hours in a hybrid box with 20 mL 20% glycerinum placed in the bottom. Twenty microlitre hybridization liquid was then added and left at 40 °C overnight. After being washed successively with 2 × SSC, 0.5 × SSC, 0.2 × SSC (15 minutes for each), the sections were blocked with blocking reagent for 30 min at 37 °C. Next, sections were incubated with biotin-digoxigenin for 1 hour at 37 °C followed by Strept Avidin-Biotin Complex (SABC) for 20 min at 37 °C. After being incubated with biotin peroxidase, sections were subjected to DAB. This was followed by hematoxylin redye, dehydration using graded ethanol and vitrification with dimethylbenzene. Sections were analysed using an EnVision Detection System (Agilent Technologies, K5007).

Fluorescence in situ hybridization (FISH)

After being fixed with 4% formaldehyde, cells were permeabilized with 0.3% Triton X-100 and blocked with 5% BSA. Cells were then pre-hybridized at 37 °C for 30 min followed by incubation with lncRNA FISH Probe Mix for hybridization at 37 °C overnight. After being washed three times, DAPI was added to stain the nucleus. Images were captured at 555 nm using confocal laser scanning microscopy (Carl Zeiss Microimaging).

RNA immunoprecipitation (RIP)

Cells were harvested for nuclear isolation before incubating with m6A antibody for 4 h at 4 °C in 1× immunoprecipitation buffer supplemented with RNase inhibitors. Prewashed protein A/G magnetic beads (30 μL) were added and incubated overnight at 4 °C. After washing 3 times and incubating with proteinase K digestion buffer, RNA was finally extracted using phenol-chloroform and analyzed by qPCR.

RNA pulldown assay

Briefly, the in vitro biotin-labelled RNAs were transcribed with 10 × Biotin RNA labeling mix (Roche, cat# 1165597910) and T7 enzyme mix (New England Biolabs, cat# M0251S), and heated at 65 °C for 5 min. Samples were cooled to room temperature to form the proper secondary structure in the presence of 10 mM HEPES, 10 mM MgCl2 and 0.1 M NaCl. The RNAs were then incubated with Streptavidin Magnetic Beads (Beyotime Biotechnology, cat# P2151) for 15–30 minutes at room temperature with agitation. Protein lysates were then mixed with the RNA-beads complex for 30–60 minutes at 4 °C with agitation or rotation. The pulldown complexes were then washed and boiled at 95–100 °C for 5–10 minutes, followed by immunoblotting.

Chromatin immunoprecipitation (ChIP) assays

Chromatin immunoprecipitation assay was performed using a ChIP kit (Millipore Corp.) following the manufacturer’s protocol. Firstly, after being cross-linked with 1% formaldehyde, DLD-1 or SW480 cells (1 × 107) were sonicated at 30% maximum power for 8 min (5 s pulse after every 10 s). Supernatants were transferred into a new tube for immunoprecipitation with 1 μg of specific antibodies or IgG antibody after centrifugation at 15000×g for 10 min. The target protein and their binding DNA complex was sedimented using prewashed agarose beads (GE Healthcare, cat# 17–0963-03). After elution and purification, DNA was analyzed by RT-qPCR. Primers used in ChIP-qPCR are listed in Supplementary Table S2.

TCGA analysis and RNAseq analysis

Gene expression data and the corresponding clinical information were obtained from TCGA repository using the *GDCquery* function of the TCGAbiolinks R package as well as a recent updated clinical data resource [35]. LncRNAs upregulated in CRC were analyzed using DESeq2 R package (log2FoldChange > 0.5 & padj< 0.05). The hypoxia signature score was calculated based on a gene set as previously described [36] using ‘ssgsea’ method of the GSVA R package, and correlations with each lncRNAs were analyzed by Pearson Correlation (coefficient > 0.15 & padj < 0.05). For the survival and kaplan-meier analysis, patients were stratified into two groups (high & low expression) using surv_cutpoint and surv_categorize function of the survminer R package and the progression-free survival was analyzed.

Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). RNA-sequencing analysis was performed at Novogene (Tianjin, China). TCGA data was downloaded and extracted using TCGAbiolinks v.2.22. The rlog transformation and differential expression analysis were performed using DESeq2 v.1.34. The differentially expressed genes (Padj ≤0.05 and log2 (fold change) ≥ 0.5) were subjected to enriched biological pathways analysis using DAVID bioinformatic Resources (2021 Update). Enriched pathways were visualized using clusterProfiler v.4.22 and ComplexHeatmap v.2.10.

Statistics

All data were from at least three independent experiments and presented as the mean ± SD. The P value was calculated using GraphPad (version 9). P < 0.05 was considered statistically significant. Comparisons between two groups and repeated measurements over a period of time were performed by two-tailed Student t test, one-way analysis of variance (ANOVA) or two-way ANOVA. Correlation between two independent groups were performed using Pearson’s Chi-square test. Kaplan-Meier method were used to generate survival curves.