Ethics approval

The housing and handling of mice follow guidelines established by Johns Hopkins Medical Institutions Animal Care and Use Committee and the National Institutes of Health. Animals are monitored daily for infection and other illnesses by trained animal technicians. Only trained laboratory personnel and animal technicians were allowed to handle laboratory animals. All individuals handling mice were registered to protocols at the Johns Hopkins Animal Care and Use Committee.

Mice

Six-week old female BALB/c mice were purchased from Taconic Biosciences (Cambridge City, IN, USA). All mice were housed in specific-pathogen free conditions at the Johns Hopkins University School of Medicine Oncology Animal Facility in Koch Cancer Research Building II (Baltimore, MD). All animal procedures followed approved protocols from the Johns Hopkins Institutional Animal Care and Use Committee and were in accordance with recommendations for proper use and care of laboratory animals.

Cell culture

CT26 tumor cells were grown in vitro in RPMI-1640 media supplemented with 10% fetal bovine serum, 50 units/mL of penicillin/streptomycin, 2 mM of L-glutamine, 1 mM of sodium pyruvate, and 2 nM of non-essential amino acids, and grown at 37 °C, 5% CO2. Cells were passaged using 0.05% Trypsin/EDTA after reaching 90 + % confluency. Cells were enumerated using a Countess II from Invitrogen (Carlsbad, CA, USA) and washed extensively with PBS before use. Salmonella SL7207 was kindly provided by Dr. Bruce Stocker (Stanford University, Stanford, CA) and grown under the recommended conditions in LB broth at 37 °C. Cells were harvested for injection when O.D. 600 reading was ~ 0.5 and washed extensively with PBS prior to injection.

Generation of luminescent Salmonella SL7207

Salmonella SL7207 was electroporated with 100 ng of pGEN-luxCDABE. pGEN-luxCDABE was a gift from Harry Mobley (Addgene plasmid # 44918; http://n2t.net/addgene: 44918; RRID:Addgene_44918). A single ampicillin resistant clone was selected, grown, and used where indicated.

Generation of Alb-IL2 protein constructs

For the generation of pcDNA3- Alb-IL2, mouse IL2 was first amplified via PCR with pcDNA3-IL2 described previously [17] and the following primers: 5′AAAgaattcGCACCCACTTCAAGCTCC-3′ and 5′- AAACTTAAGTTATTGAGGGCTTGTTGA -3′. The amplified product was then cloned into the EcoRI/Afl II sites of pcDNA3-Alb [18].

The plasmid constructs were confirmed by DNA sequencing. Alb-IL2 proteins were expressed using Expi293F expression system kit from Thermo Fisher Scientific (Waltham, MA, USA) according to manufacturer’s instructions. Expi293F cells were transfected with Alb-IL2. Proteins were purified by HiTrap Albumin column from GE Healthcare Life Sciences (Marlborough, MA, USA).

Tumor challenge and treatment

For CT26 cell challenge, 2 × 105 tumor cells were injected subcutaneously into six-week-old female BALB/c mice. 5 × 106Salmonella were injected intravenously at the indicated time points. Mice were injected intravenously with 50 µg of Alb-IL2 protein prepared in sterile PBS. Tumors were measured (1/2 ×  (long diameter  × short diameter2)) at the indicated points and were euthanized in accordance with the approved animal care and use protocol.

Preparation of single cell suspensions for flow cytometric analysis

For tumor specific immune profiling, tumor draining lymph nodes (LN) were collected from CT26 tumor bearing mice that were treated as indicated. The LNs were dissociated using a syringe plunger and 70uM filter and washed using fluorescence-activated cell sorting (FACS) buffer from Thermo Fisher Scientific. Cell suspensions were then RBC lysed, washed, and resuspended in FACS buffer for downstream analysis.

Flow cytometric acquisition and analysis

For all experiments utilizing flow cytometry, single cell suspensions were prepared and extensively filtered prior to acquisition. Single staining controls of ultracomp beads from Thermo Fisher Scientific were used to set compensation matrix for each experiment. Negative gates were determined using appropriate Fluorescence Minus One or isotype controls as appropriate. Prior to antibody staining, Zombie Aqua live/dead from BioLegend (San Diego, CA, USA) was used to dead cells. Fc Block was used prior to antibody staining. Antibody and tetramer dilutions were determined through titration. All samples were acquired on a 13-color B-Y-R-V CytoFLEX S from Beckman Coulter (Brea, CA, USA). Compensation was generated using single-staining controls and CytExpert 2.0 software from Beckman Coulter. Analysis was performed using either CytExpert 2.0 or FlowJo v10 from BD Biosciences (Franklin Lakes, NJ, USA). All antibodies used in the analysis can be found in Table 1.

Intracellular staining

To stain for intracellular cytokines, samples were incubated with PMA/Ionomycin cell stimulation cocktail and Brefeldin A + Monensin Golgi Plug from Thermo Fisher Scientific for 4 h at 37 °C. Cells were then collected and prepared as described in the flow cytometry section. Prior to intracellular staining, cells were permeabilized using eBioscience Foxp3 / Transcription Factor Staining Buffer Set from Thermo Fisher Scientific and stained for intracellular cytokines.

Generation of fluorescent Alb-IL2

Alb-IL2 was labeled using Alexa Fluor 647 NHS Ester (Succinimidyl Ester) from Thermo Fisher Scientific according to manufacturer’s instructions. Free dye was removed using a 7000 Da MW Zebra Spin Desalting Column from Thermo Fisher Scientific.

In vivo imaging system (IVIS) imaging

The trafficking of Alexa-647-Alb-IL2 and luminescent Salmonella SL7207 was observed using IVIS Series 2000 from PerkinElmer (Waltham, MA, USA). Alb-IL2 was labeled using Alexa Fluor 647 NHS Ester (Succinimidyl Ester) from Thermo Fisher Scientific according to manufacturer’s instructions. 50ug of protein was injected intravenously through the retroorbital sinus. After 18 h, mice were euthanized and the tumor, spleen, lymph nodes, and liver were removed and immediately imaged via the IVIS Spectrum with the following settings: 10 s exposure, excitation filter blocked, emission filter open, FOV 22.7, Binning: 8. Fluorescent signals from Alexa-647-Alb-IL2 were quantified as average radiance using Living Image 3.0 Software by Xenogen (Alameda, CA, USA). Bioluminescence imaging of Luminescent Salmonella SL7207 was conducted on the IVIS Spectrum with the following settings: 5 s exposure, excitation filter blocked, emission filter open, FOV 22.7, Binning: 8. Luminescent signals were quantified as average radiance using Living Image 3.0 Software by Xenogen.

Statistical analysis

All data are expressed as means ± standard error of the mean (S.E.M). Results for flow cytometry analysis, IVIS imaging, and tumor treatment experiments were evaluated by analysis of variance (one-way ANOVA) and the Tukey–Kramer multiple comparison test where appropriate. Comparisons between individual data points were made using Student’s t-tests. Survival analysis was performed using Kaplan–Meier survival curves and log-rank tests. All P values < 0.05 were considered significant. Of note, *, **, ***, and *** indicate P values less than 0.05, 0.01, 0.001, and 0.0001 respectively. NS, not significant. All statistical calculations were performed in GraphPad Prism 9.