Experimental animals

Six-week-old C57BL/6 J male mice were purchased from Clea Japan and underwent acclimatization for a week before experiments. The CAG–CAT–lacZTg/Tg mouse was kindly provided by J. Miyazaki.17 The CtskCre/Wt mouse was generated as previously described.18 These mice were maintained at Tokyo Medical and Dental University under specific pathogen-free conditions. During the course of the experiment, the body weight of the mice was measured every day. The number of mice used in each experiment is described in the corresponding figure. All animal experiments were approved by the Institutional Animal Care and Use Committee and Genetically Modified Organisms Safety Committee of Tokyo Medical and Dental University (approval No. A2021-028C2 and G2018-028C15, respectively) and conducted in accordance with the guidelines concerning the management and handling of experimental animals.

Drug administration

Mice were orally administered 10 mg·kg−1 per day of LAMZ, linifanib or a control emulsion once a day for 14 days. Oral administration was performed using a feeding needle (Natsume Seisakusho).47 The LAMZ and linifanib emulsions were prepared to be 1 mg·mL−1 in the following solution: 2.5% ethanol, 2.5% dimethyl sulfoxide (DMSO), 5% Tween 80 and 25% PEG 400 in phosphate–buffered saline (PBS).48 For subcutaneous injection, LAMZ was dissolved into propylene glycol at a concentration of 1.2 mg·mL−1. Five mL·kg−1 of the solution was injected into the backs of the mice twice daily for 14 days. The SR18292 solution for the intraperitoneal injection was prepared to be 6 mg·mL−1 in the following solution: 10% DMSO and 10% Tween 80 in PBS.49 A total of 7.5 mL·kg−1 of the solution was injected per day for 14 days.

Mouse models

To mimic disuse–induced frailty, we performed a tail-suspension procedure on the mice with a suspension device (Takatsuka Life Science). The tail of the subject mouse was hung from the beam of the device using a chain and an adhesive bandage so the hindlimb of the subject did not reach the floor. Endurance capacity was tested using a treadmill device (Muromachi Kikai). Mice underwent forced running on the device with the following parameters: inclination, 7°; speed, 16 m·min.−1; duration, 15 min; electric shock intensity, 2 mA. The contact time and frequency on the posterior edge of the belt were automatically recorded. Fatigue-like behavior (times) was defined as the number of contacts in the last 10 min. Fatigue-like behavior (sec) was calculated as the time of contact in the last 10 min. The distance traveled was acquired by multiplying the speed and running time without fatigue-like behavior in the last 10 min. Maximum muscle strength was measured using a grip strength meter (Muromachi Kikai). A subject mouse was placed on a wire mesh, and its tail was gently pulled. The resistance strength against being pulled away from the mesh was measured 10 times per mouse. The maximum and minimum values were excluded, and the mean value of the remaining values was calculated.

Peripheral blood collection

Peripheral blood was collected from the submandibular vein or the heart. For the analysis of the LAMZ concentration in the plasma, blood was collected in a microtube containing EDTA, the final concentration of which was 2 mg·mL−1. Samples then underwent centrifugation (1 600 g, 10 min, 4 °C), and plasma was collected in microtubes. The plasma was snap-frozen using liquid nitrogen and stored at –80 °C. For the blood cell count, blood flowing from the mandible was collected using a hematocrit capillary treated with heparin (AS ONE) and immediately transferred into microtubes containing EDTA at a final concentration of 2 mg·mL−1. Blood cells were counted using a diagnostic device (Nihon Kohden). Blood glucose was measured after fasting for 14 hours using a diagnostic device (Nipro). For serum biochemistry, peripheral blood was collected from the heart. After collection, the blood sample was left in a microtube at room temperature for 30 min. Then, the sample underwent centrifugation (10 000 r·min−11, 10 min., RT), and the serum was collected in another microtube and stored at –80 °C. The serum biochemistry profile was analyzed at Oriental Yeast Co., Ltd.

Tissue harvest and preparation

For the evaluation of the bone formation rate, mice were injected with calcein (16 mg·kg−1) 4 days and 1 day prior to sacrifice. After the mice were sacrificed by anesthesia, the bone samples for the micro-CT analysis and histomorphometric analysis were fixed with 70% ethanol at 4 °C. The samples for histological analyses underwent fixation with 4% paraformaldehyde (PFA) at 4 °C overnight. The tissues for the gene expression analyses were minced in Sepasol®-RNA I Super G (Nacalai Tesque) and stored at –80 °C. The muscle and bone samples for measuring the drug concentration were snap-frozen using liquid nitrogen and stored at –80 °C.

Quantification of the drug concentration

Plasma, muscle and bone were mixed with methanol and an internal control. These samples were processed with 0.1 mol·L−1 NaOH, a solid-phase extraction plate (Waters) and 5% methanol, eluted with acetonitrile–ethanol and dissolved in formic acid–acetonitrile. The concentration of LAMZ in each sample was measured by liquid chromatography/mass spectrometry (LC/MS/MS, Shimadzu and Applied Biosystems).

Micro-CT analysis

The fixed femur was radiologically scanned using a ScanXmate-A100S Scanner (Comscan Techno). A three-dimensional image of the femur was reconstructed, and the structural indices were calculated using TRI/3D-BON software (RATOC Systems).

Histomorphometric analysis of the bone

For the analysis of osteoblastic bone formation and osteoclastic bone resorption in vivo, undecalcified tibiae were embedded in glycol methacrylate (GMA). The blocks of GMA were sectioned (5 μm) and subjected to toluidine blue staining or tartrate-resistant acid phosphatase (TRAP) staining. The parameters for bone formation and resorption in the secondary trabecular bone were assessed under microscopy (Axio Imager 2, Zeiss) and WinROOF 2013 v.1.4.1 software (Mitani). The width of the articular cartilage was measured using measurement software (BZ–X analyzer, Keyence).

Histological analysis of the tissues

The fixed muscles were dehydrated and embedded in paraffin. Six-micrometer-thick sections were cut. The sections were stored at 4 °C until staining. After deparaffinization and hydration of the sections, the sections underwent staining. For hematoxylin and eosin staining, the sections were stained with hematoxylin (Muto Pure Chemicals) for 3 min followed by 2 min of staining with eosin (Wako). For modified Gomori’s trichrome staining, the sections were stained with hematoxylin (Muto Pure Chemicals) for 3 min followed by 10 min of staining with modified Gomori’s trichrome staining solution (Chromotrope 2 R, 9.6 mg·mL−1; Fast green FCF, 4.8 mg·mL−1; phosphotungstic acid hydrate 9.6 mg·mL−1; and acetic acid, 16 μL [pH 3.4]). The histological images were captured, and muscle fiber width and tendon width (the minor axes) were measured using measurement software (BZ–X analyzer, Keyence).50

Isolation of cells from the mice

Osteoblast and osteoclast progenitors were harvested from neonatal and 6- to 8-week-old mice, respectively.15,51 Neonatal mice were sacrificed by anesthesia. After disinfection of mice using immersion in ethanol, the calvaria were dissected. Dissected tissue was digested in the following solution: 1 mg·mL−1 collagenase (Fujifilm Wako Pure Chemical) and 2 mg·mL−1 dispase (Fujifilm Wako Pure Chemical) in α-modified minimum essential medium (α-MEM) (Gibco). After digestion, tissue debris was removed, and osteoblastic cells were collected.

Bone marrow cells (BMCs) were harvested from the femur and tibia by introducing PBS into the bone marrow cavity. Erythrocytes were depleted using ammonium chloride (Sigma). Tissue debris was removed, and BMCs were collected. The collected cells underwent the experiments described below.

Chemical compounds used in the in vitro experiments

The first screening was conducted using a chemical library (Stem SelectTM Small Molecule Regulators 384-Well Library I, Merck). Each compound was diluted to 10 mmol·L−1 so that the final concentration in the cell culture plate would become 10 μmol·L−1. The compounds used in the experiments other than primary screening were purchased individually: AICAR (Calbiochem), monastrol (Santa Cruz Biotechnology), PARP inhibitor XII (Calbiochem), AMI-5 (Calbiochem), 17b (Calbiochem), IWR-1-endo (Calbiochem), apocynin (Santa Cruz Biotechnology), L-165, 041 (Abcam Limited), linifanib (Cayman Chemical Company), SR18292 (Cayman Chemical Company), FK506 (Cayman Chemical Company) and KN93 (Cayman Chemical Company). These compounds were dissolved in DMSO (Sigma) so that their concentrations were 1 000 times greater than the final concentration.

In vitro myotube differentiation

C2C12 cells were seeded onto cell culture plates at the following concentrations: 5.0 × 103 cells per well for the 96-well plate and 1.5 × 104 cells per well for the 48-well plate. After 1 day (Day 0), these cells were differentiated into myotubes by a differentiation medium, Dulbecco’s modified Eagle’s medium (DMEM) with 1 μg·mL−1 insulin and 2% horse serum. The differentiation medium was changed on Days 2, 3, 4, 5 and 6. Analyses were conducted on Day 7 unless otherwise indicated. LAMZ was added on Days 0, 2 and 4 at a concentration of 1 μmol·L−1. The PGC-1α inhibitor SR18292 was added on Days 0 and 2 at a concentration of 20 μmol·L−1. The calcineurin inhibitor FK506 was added on Days 0, 2, 4 and 6 at a concentration of 2 μmol·L−1.

CloneticsTM Skeletal Muscle Myoblast Cell Systems (Lonza) was used for the analyses of human skeletal muscle. Cells with a population doubling number lower than seven were seeded onto cell culture plates at the following concentrations: 6.4 × 103 cells per well for the 96-well plate and 1.5 × 104 cells per well for the 48-well plate. After 1 day (Day 0), myotube differentiation was induced by adding DMEM-F12 with 2% horse serum (Lonza) and LAMZ (0.1 μmol·L−1). The differentiation medium was changed on Day 2. Analyses were conducted on Day 4.

For the primary screening, C2C12 cells were stimulated with the compounds included in the chemical library on Days 0, 2 and 4. On Day 7, these cells were fixed with 4% PFA at room temperature for 15 min. Cytosol was stained using HCS CellMask™ Deep Red Stain (Thermo Fisher Scientific), and nuclei were stained using Hoechst 33342 (Sigma). The number of cells and nuclei in each cell was measured with an IN Cell Analyzer 2000 (GE Healthcare). The number of cells and the number of multinuclear cells were normalized by cells stimulated with vehicle and are expressed as the relative cell number and relative myotube formation, respectively.

Myosin heavy or light chain expression was examined by immunocytofluorescence. Myotubes were fixed with 4% PFA at room temperature. The sections were then incubated with primary antibody solutions containing a mouse anti–myosin heavy chain antibody (MF20, dilution: 1/50, R&D Systems) or a mouse anti–myosin light chain antibody (MY20, dilution: 1/100, GeneTex) at room temperature for 3 h, followed by incubation with secondary antibody solutions containing a donkey anti–mouse IgG antibody conjugated with the fluorescence dye Alexa Fluor 594 (dilution: 1/500, Life Technologies) or Alexa Fluor 488 (dilution: 1/500, Life Technologies) for 1 hour. Nuclei were stained using Hoechst 33342 (Sigma). The stained images were obtained with a microscope (BZ–X analyzer, Keyence).

In vitro osteoblast differentiation

Murine osteoblast progenitor cells (calvarial and MC-3T3-E1 cells) were seeded on cell culture plates at the following concentrations: 4.0 × 103 cells per well for the 96-well plate and 7.5 × 103 cells per well for the 48-well plate. After 1 day (Day 0), these cells underwent differentiation with an osteogenic medium containing 50 μg·mL−1 ascorbic acid, 10 nmol·L−1 dexamethasone and 10 mmol·L−1 β–glycerophosphate in α-MEM. The differentiation medium was changed every third day. LAMZ was added on Days 0, 3, 6, 9 and 12 at a concentration of 1 μmol·L−1. The PGC-1α inhibitor SR18292 was added on Days 0 and 3 at a concentration of 20 μmol·L−1. The CaMKII inhibitor KN93 was added on Days 0, 3, 6, 9 and 12 at a concentration of 2 μmol·L−1.

PoieticsTM human mesenchymal stem cells (Lonza) were used for analyses of human osteoblasts. These cells were seeded onto 48-well plates at a concentration of 7.2 × 103 cells per well. After 1 day (Day 0), osteoblastogenesis was induced with hMSC differentiation basal medium-osteogenic (Lonza) supplemented with LAMZ (1 μmol·L−1). The differentiation medium was changed every third day.

For the secondary screening, MC3T3-E1 cells were stimulated with the candidate compounds for seven days. After fixation with 4% PFA at room temperature, these cells were supplemented with a substrate for alkaline phosphatase (ALP), p-nitrophenylphosphate disodium (Fujifilm Wako Pure Chemical), and incubated for 30 min at 37 °C without detaching the cells from the plate, unlike the conventional procedure.14,15 The catalysis of the substrate was halted by the stop solution 0.2 mmol·L−1 sodium hydroxide. A plate reader (Bio-Rad Laboratories) was used for the detection of the p-nitrophenylphosphate disodium catabolite p-nitrophenol (wavelength: 405 nm).

ALP staining and quantification were performed as follows. Osteoblasts were fixed with 4% PFA for 15 min on ice. After the cells were rinsed with PBS, they were stained for 15 min with ALP staining solution (Napthol AS-MX phosphate, 0.06 mg·mL−1; N,N-dimethylformamide, 1%; and Fast blue BB salt, 1 mg·mL−1 in 0.1 mmol·L−1 Tris-HCl [pH 8.0]). The staining solution was washed away with dH2O. The stained cells were air-dried. The stained images were obtained under microscopy (BZ–X analyzer, Keyence). The images were then converted into black and white images for the quantification of the intensity (Photoshop 2020, Adobe).

Mineralization was detected by Alizarin Red S (ARS) staining on Day 14. Cells were fixed with 4% PFA for 15 min on ice. After the cells were rinsed with dH2O, ARS staining was performed (0.02 g·mL−1 Alizarin Red S in dH2O [pH 4.2]). The staining solution was washed away with dH2O and air dried. The stained images were obtained under microscopy (BZ–X analyzer, Keyence).

In vitro osteocyte differentiation

The murine immature osteocyte cell line IDG-SW3/1G9 was used in the experiments.52 These cells were seeded on a collagen-coated 24-well plate (Corning) at a concentration of 2.5 × 104 cells per well. After 1 day (Day 0), these cells underwent differentiation with differentiation medium containing 50 μg·mL−1 ascorbic acid and 4 mmol·L−1 β–glycerophosphate in α-MEM. The differentiation medium was changed every third day. LAMZ was added on Days 0 and 9 at a concentration of 0.1 μmol·L−1.

Analyses of mitochondria in cultured cells

C2C12 cells and MC3T3-E1 cells treated with LAMZ (1 μmol·L−1) were analyzed for their mitochondrial content on Days 3 and 6. MitoTracker® Deep Red (Thermo Fisher Scientific) was incorporated into these cells for 30 min before fixation. Fixation was conducted with 4% PFA at room temperature for 15 min. Nuclei were stained using Hoechst 33342 (Sigma). The stained images were obtained under microscopy (BZ–X analyzer, Keyence).

Visualization of intracellular calcium in vitro

C2C12 cells or MC3T3-E1 cells were seeded in a 96-well plate at a concentration of 5.0 × 103 cells per mL. One day after incubation, these cells were loaded with Fluo 4 AM (Dojindo Laboratories) for 1 h. The loaded cells were then stimulated with LAMZ (10 μmol·L−1) for 4 h. Visualized intracellular calcium was acquired and quantified under microscopy with measurement software (BZ–X analyzer, Keyence).

Gene knockdown

The plasmids for producing lentivirus that code shRNAs targeting Mef2c and gfp (control) were purchased from Sigma-Aldrich. These plasmids were transfected into HEK293T cells using FuGENE HD transfection reagent (Promega). The number of lentiviral particles (LP) was calculated by measuring p24 expression with an enzyme–linked immunoassay (ELISA) kit (TaKaRa). The viral titer was calculated by assuming 1 inclusion forming unit (IFU) = 100 LP. The lentiviruses were used to infect C2C12 cells or MC3T3-E1 cells at a multiplicity of infection (MOI) of 100. One day after infection, myogenic or osteogenic differentiation was induced with or without LAMZ as described above. Puromycin (2 μg·mL−1) was added at the same time as LAMZ to eliminate uninfected cells.

In vitro osteoclast differentiation from mouse BMCs

Primary BMCs were seeded on cell culture plates at the following concentrations: 2.5 × 105 cells per well for the 96-well plate, 1.3 × 105 cells per well for the 48-well plate and 2.0 × 105 cells per well for the 24-well plate. BMCs were expanded in α-MEM with 10 ng·mL−1 macrophage colony–stimulating factor (M-CSF) (R&D systems) for 2 days before the induction of differentiation. These cells were stimulated with differentiation medium containing 10 ng·mL−1 M-CSF and 25 ng·mL−1 RANKL (PeproTech) in α-MEM at Day 0. The differentiation medium was changed on Day 2. Cells were analyzed on Day 3 unless otherwise indicated.

Tertiary screening was conducted using BMCs harvested from CAG–CAT–lacZTg/WtCtskCre/Wt mice. On Day 3, the differentiation medium was washed away using PBS, and a substrate of β-galactosidase, 6-O-β-galactopyranosyl-luciferin (Promega), was added. After 30 min of incubation, catabolites were detected based on chemiluminescence (wavelength: 560 nm) using a plate reader (PerkinElmer).

TRAP+ multinuclear cells were detected by TRAP staining. On Day 3, osteoclasts were fixed with 4% PFA for 15 min on ice. Membrane delipidation was performed using an acetone–ethanol solution (1:1 v/v) for 30 s. TRAP staining solution was then applied, and the cells were incubated for approximately 5 min at room temperature until the cells positive for TRAP became pale pink. The composition of the staining solution was as follows: 0.1 mg·mL−1 naphthol AS-MX phosphate (Sigma-Aldrich), 10 μL·mL−1N,N-dimethylformamide (Nacalai Tesque), and 0.6 mg·mL−1 fast red violet LB salt (Sigma-Aldrich) in a TRAP buffer (5.44 g·L−1 sodium acetate and 10.5 g·L−1 sodium tartrate). The stained images were obtained under a microscope (BZ–X analyzer, Keyence), and TRAP+ cells with 10 or more nuclei were regarded as osteoclasts.

Apoptotic cells were detected by TdT-mediated dUTP nick-end labeling (TUNEL) assay. BMCs that had undergone osteoclastogenesis in the presence of LAMZ (0.01 μmol·L−1) were fixed on Day 2. The fragmented DNA of the apoptotic cells was detected using the DeadEndTM Fluorometric TUNEL System (Promega) according to the manufacturer’s instructions. Fluorescein-12-dUTP was incorporated into the fragmented DNA at the 3’ end, which was detected under microscopy (BZ–X analyzer, Keyence).

Cleaved caspases 3 and 8 were detected by immunocytofluorescence. BMCs were fixed with 4% PFA at 4 °C on Day 2. The cells were then incubated with a primary antibody solution containing a rabbit anti–cleaved caspase 3 antibody (polyclonal, dilution: 1/400, Cell Signaling Technology) or a rabbit anti–cleaved caspase 8 antibody (D5B2, dilution: 1/400, Cell Signaling Technology). Nuclei were stained using Hoechst 33342 (Sigma). The stained images were obtained under microscopy (BZ–X analyzer, Keyence).

Quantitative reverse transcriptase–polymerase chain reaction (qRT-PCR)

The total RNA of mouse tissues was extracted as described above, and that of the cultured cells was extracted using a Maxwell RSC simple RNA Tissue Kit (Promega). cDNA was synthesized from the extracted RNA using ReverTra Ace® (TOYOBO). qRT-PCR analysis was performed with SYBR Green Real-time PCR Master Mix (TOYOBO) using a Light Cycler apparatus (Bio-Rad Laboratories). Gene expression was calculated using the ΔΔCt method, and Gapdh expression was used for normalization. The primer sequences are listed below: Gapdh, 5′–ACCCAGAAGACTGTGGATGG–3′ and 5′–CACATTGGGGGTAGGAACAC–3′; Myod1, 5′–AACCCCAATGCGATTTATCA–3′ and 5′–CGAAAGGACAGTTGGGAAGA–3′; Myog, 5′–CTGCACTCCCTTACGTCCAT–3′ and 5′–ACCCAGCCTGACAGACAATC–3′; Klf5, 5′–GGTTGCACAAAAGTTTATAC–3′ and 5′–GGCTTGGCGCCCGTGTGCTTCC–3′; Mef2c, 5′–CGCAGGGAATGGATACGGCAAC–3′ and 5′–GGGATAAGAACGCGGAGATCTGG–3′; Runx2, 5′–CCCAGCCACCTTTACCTACA–3′ and 5′–TATGGAGTGCTGCTGGTCTG–3′; Sp7, 5′–ACTGGCTAGGTGGTGGTCAG–3′ and 5′–GGTAGGGAGCTGGGTTAAGG–3′; Alpl, 5′–AACCCAGACACAAGCATTCC–3′ and 5′–GCCTTTGAGGTTTTTGGTCA–3′; Sost, 5′–GGAATGATGCCACAGAGGTCA–3′ and 5′–CGTCATAGGGATGGTGGGGA–3′; Ppargc1a, 5′–AGTCCCATACACAACCGCAG–3′ and 5′–ACCCTTGGGGTCATTTGGTG–3′; Fos, 5′–CAGCCTTTCCTACTACCATTCC-3′ and 5′–ACAGATCTGCGCAAAAGTCC–3′; Mef2c, 5′–CGCAGGGAATGGATACGGCAAC-3′ and 5′–GGGATAAGAACGCGGAGATCTGG-3′; Mef2c (for the analyses of knockdown efficiency), 5′–TATGTGCCGTGTGTGGAAAA-3′ and 5′–AGTGCTAAGCGTATCTCAGC-3′; GAPDH, 5′–TGACCACAGTCCATGCCATC–3′ and 5′–GATGATGTTCTGGAGAGCCCC–3′; MYOD1, 5′–GCCACAACGGACGACTTCTA–3′ and 5′–CGAGTGCTCTTCGGGTTTCA–3′; MYOG, 5′–ATCATCTGCTCACGGCTGAC–3′ and 5′–GGGCATGGTTTCATCTGGGA–3′; PPARGC1A, 5′–ACACTTTGCGCAGGTCAAACG–3′ and 5′–TGGTGGAAGCAGGGTCAAAG–3′; RUNX2, 5′–ACTGGGCCCTTTTTCAGACC–3′ and 5′–GGACATACCGAGGGACATGC–3′; SP7, 5′–ATCCAGCCCCCTTTACAAGC–3′ and 5′–TGAGTGGGAAAAGGGAGGGTA–3′.

RNA sequencing

The total RNA of cultured calvarial cells was extracted using a Maxwell 16 LEV simplyRNA Tissue Kit (Promega). Data were acquired on an Ion Proton (Thermo Fisher) and analyzed using CLC Genomics Workbench (CLC). k-means clustering and Gene Ontology enrichment analysis were performed using an online tool, iDEP.91.53

Western blotting analysis

For analysis of PLCγ1 phosphorylation, C2C12 cells or MC3T3-E1 cells were stimulated with LAMZ (10 μmol·L−1) after serum starvation (6 hours). The total proteins of these cells were extracted with lysis buffer containing Triton X–100 (1%), NaCl (150 mmol·L−1), Tris-HCl (50 mmol·L−1), EDTA (1 mmol·L−1), sodium deoxycholate (0.5%), Na4P2O7⋅10H2O (40 mmol·L−1), NaF (50 mmol·L−1), Na3VO4 (1 mmol·L−1), PMSF (2 mmol·L−1) and cOmpleteTM Protease Inhibitor Cocktail (Roche Bioscience). The extracted proteins underwent SDS–PAGE and were transferred to PVDF membranes (pore size: 0.45 μm, Merck), followed by immunoblotting using the following antibodies: PLCγ1 (1/1 000, CST), phospho–PLCγ1 S1248 (1/1 000, CST), and β-actin (1/5 000, Merck). The blots were visualized using the following reagents: horseradish peroxidase (HRP)–linked anti–mouse IgG, HRP–linked anti–rabbit IgG (1/5 000, GE Healthcare), and a luminol reagent (Nacalai Tesque). Densitometric analysis of the bands was conducted using Photoshop 2020 (Adobe).

Statistical Analysis

All of the data are representative of more than three independent experiments and were initially tested with the F test or Bartlette’s test for normality distribution. If homoscedasticity could be assumed, they were analyzed with a parametric test using Student’s t test, one-way analysis of variance (ANOVA) followed by Dunnett’s or Tukey’s multiple-comparison test or two–way ANOVA followed by Tukey’s multiple-comparison test. In cases in which homoscedasticity could not be assumed, Welch’s t test or Brown–Forsythe ANOVA test followed by Dunnett’s T3 test were applied. Differences with a p value of <0.05 were considered significant (*P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.000 1; N. S., not significant, throughout the paper). All data are presented as the mean ± standard error of the mean values. All statistical analyses were performed with Prism 8 (GraphPad Software).