Human samples

Control human synovial tissue was obtained from the individuals with anterior cruciate ligament injury with no history of arthritic diseases (n = 16). Human RA synovium and cartilage were obtained from patients who underwent total knee replacement surgery (n = 16). Control cartilage was obtained from the lateral tibial plateau with reduced cartilage destruction in OA patients who underwent total knee replacement surgery (n = 16). The clinical characteristics of RA patients are listed in Table S1. RA and control adipose tissue were obtained from the infrapatellar fat pads (IPFPs) of RA and OA patients who underwent total knee replacement surgery (n = 6 per group). Control adipose tissue was obtained from the infrapatellar fat pads (IPFPs) of RA patients who underwent total knee replacement surgery (n = 6). Human synovial tissue was analyzed by hematoxylin and eosin (HE) staining, immunofluorescence (IF) staining, and immunohistochemistry (IHC). All human samples were obtained from the Third Affiliated Hospital of Southern Medical University (Guangzhou, China). All patients provided informed consent to use their clinical information for scientific research. This study was approved by the Ethics Committee of the Third Affiliated Hospital of Southern Medical University.

Animals

Lys-MCre mice and Tsc1flox/flox mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA; Jax nos. 004781 and 005680, respectively). Rheb1flox/flox mice were a generous gift from Professor Bo Xiao of Sichuan University. To generate myeloid lineage-specific Tsc1- or Rheb1-knockout mice, Lys-MCre mice were crossed with Tsc1flox/flox mice and Rheb1flox/flox mice. Mice with myeloid lineage-specific deletion of Tsc1 were called TSC1KO mice, and those with Rheb1 deletion were called Rheb1KO mice. Littermates carrying Tsc1flox/flox or Rheb1flox/flox without Cre were used as wild-type mice. Routine genotyping of tail DNA was performed according to the Jackson Laboratory’s instructions. The gross appearance of TSC1KO mice and Rheb1KO mice has previously been reported.25 One hundred and twenty eight-week-old male C57BL/6 J mice were purchased from the Experimental Animal Centre of Southern Medical University (Guangzhou, China). To examine the role of FABP4 in experimental RA, eighty twelve-week-old male C57BL/6 J mice were randomly separated into three groups: the sham group was intra-articularly treated with phosphate-buffered saline (n = 30); the antigen-induced arthritis (AIA) group was intra-articularly injected with phosphate-buffered saline (n = 30); and the rmFABP4 group was administered rmFABP4 after AIA modeling (n = 20). To determine the role of the mTORC1 pathway in experimental RA, twenty twelve-week-old male TSC1KO mice, twenty twelve-week-old male Rheb1KO mice, and their littermates were subjected to AIA surgery. To examine the role of FABP4 inhibition in experimental RA, sixty twelve-week-old male TSC1KO mice were randomly separated into three groups: Group 1 (n = 20) animals underwent AIA and were administered physiological saline; Group 2 (n = 20) animals underwent AIA with administration of BMS309403; and Group 3 (n = 20) animals underwent AIA and were administered anagliptin. Additionally, forty twelve-week-old male C57BL/6 J mice were randomly separated into two groups: Group 1 (n = 20) animals underwent AIA and were treated with physiological saline; and Group 2 (n = 20) animals underwent AIA with treatment of BMS309403. The animals were sacrificed at 4, 8 or 12 weeks after AIA modeling, and 10 mice were sacrificed at each time point. All animals were provided a standard diet and were housed in pathogen-free cages (5 mice per cage) with constant temperature and humidity. The circadian rhythm was maintained at 12 h. Euthanasia was performed by an overdose of ketamine/xylazine followed by cervical dislocation. All animal experiments were approved by the Southern Medical University Committee Animal Care and Use Committee and were performed in accordance with the Committee’s guidelines and regulations.

Antigen-induced arthritis (AIA)

The experimental mouse model of antigen-induced arthritis (AIA) was established as described previously.54 Briefly, 12-week-old male C57BL/6 J mice, TSC1KO mice and Rheb1KO mice were injected subcutaneously on Day 0 with 500 μg of methylated bovine serum albumin (mBSA; Sigma–Aldrich, USA) in 50 μL of phosphate buffered saline (PBS) emulsified in 50 μL of Freund’s complete adjuvant (CFA; Sigma–Aldrich, USA). Two weeks later, 10 μg of mBSA (in 10 μL sterile saline) was injected into the right knee joint of each mouse. Mice that were intra-articularly injected with PBS were used as controls. On Day 3 after AIA, the mice were administered rmFABP4, BMS309403, anagliptin or vehicle.

Histological analysis

Total knee joints were fixed in 4% paraformaldehyde for 24 h, decalcified with 0.5 mol·L−1 EDTA (pH 7.4) for 21 days and subsequently embedded in paraffin. The samples were cut into 4 µm-thick sections for hematoxylin and eosin (HE) and Safranin O/Fast Green staining. The synovial membranes in routine HE-stained slides were graded according to three synovial membrane features (synovial lining cell layer, stromal cell density and inflammatory infiltrates). The alterations were ranked on a scale: none (score: 0), slight (score: 1), moderate (score: 2), and strong (score: 3).55 Cartilage degeneration in safranin O/fast green-stained sections was graded using the Osteoarthritis Research Society International (OARSI) scoring system. We applied this 0–6 subjective scoring system to all four quadrants of the joint: medial femoral condyle (MFC), medial tibial plateau (MTP), lateral femoral condyle (LFC), and lateral tibial plateau (LTP). A score of 0 represents normal cartilage, 0.5 = loss of proteoglycan with an intact surface, 1 = superficial fibrillation without loss of cartilage, 2 = vertical clefts and loss of surface lamina, 3 = vertical clefts/erosion to the calcified layer lesion over 1%–25% of the quadrant width, 4 = lesion reaches the calcified cartilage over 25%–50% of the quadrant width, 5 = lesion reaches the calcified cartilage over 50%–75% of the quadrant width, and 6 = lesion reaches the calcified cartilage over >75% of the quadrant width. Each section was assessed by two blinded, independent graders, and the average score was used for statistical analysis.

Cell preparation

Human umbilical vein endothelial cells (HUVECs) and fibroblast-like synoviocytes (FLSs) were purchased from the ATCC. Human primary chondrocytes were obtained from the tibial plateaus of OA and RA patients. Murine primary chondrocytes were obtained from the tibia cartilage of newborn mice as previously described.56 Bone marrow-derived macrophages (BMDMs) were obtained from the bone marrow of 6-week-old female C57BL/6 J and TSC1KO mice and their littermate controls. Macrophages and their supernatant were collected after being stimulated with 50, 200, or 500 ng·mL−1 LPS (Invitrogen, San Diego, CA, USA) for 12 h or 24 h. HUVECs, FLSs, and primary chondrocytes were treated with 0.4 μmol·L−1 recombinant human FABP4 (#RPB693Hu01, Cloud-Clone Corp., China), M1-polarized macrophage supernatant, or 20 μmol·L−1 BMS309403 (MedChemExpress, Shanghai, China) for 1 hour to examine pathway activation or 24 h to examine phenotypic alterations. HUVECs were treated with rhFABP4 for 24 h after 24 h of FABP lentivirus infection. Macrophages were collected after the administration of 500 ng·mL−1 LPS, 50 μmol·L−1 MHY1485 (MedChemExpress, Shanghai, China), or 100 μmol·L−1 rapamycin (MedChemExpress, Shanghai, China) for 6 h.

Knockdown of FABP4 in HUVECs

The shRNAs targeting human FABP4 were carried by the PLKO.1 lentivirus packaging system provided by Hanbio Biotechnology (Shanghai, China). Lentiviruses carrying three shRNAs (FABP4-shRNA1: GGCATGGCCAAACCTAAA-TGATCA; FABP4-shRNA2: GGGTGTCCTGGTACA-TGTGCAGAAA; FABP4-shRNA3: CCACGAGAGTTTATGAGAGAGCATA) targeting FABP4 and the corresponding negative control (FABP4-control: TTCTCCGAACGTGTCACGTAA) were used to knock down FABP4 in HUVECs. Briefly, cells at 40%–50% confluence were infected with lentivirus supernatant and incubated at 37 °C for 48 h. The knockdown efficiency of shRNAs targeting FABP4 was determined by Western blotting.

Tube formation assay

HUVECs were seeded with 200 µL of Matrigel (BD Biosciences, NSW, Australia) in a 24-well dish at a cell density of 65 000 cells per well. Tube formation was assessed after 12 h by visual microscopy using an inverted microscope (Olympus, Tokyo, Japan). The different parameters of tube formation were analyzed using the Angiogenesis analysis plugin in ImageJ software.

Proliferation assay

The proliferation rates of HUVECs and FLSs were measured using a CCK-8 assay (Dojindo Laboratories, Tokyo, Japan). The absorbance was measured at 450 nmol·L−1 with a microplate reader (BOP-TEK) according to previously published methods.57,58

HUVECs and FLSs were plated in a 12-well plate at a density of 150 000 cells per well. After being infected with rhFABP4, M1-polarized macrophage supernatant, or BMS309403 for 24 h, the cells were incubated with 100 μg·mL−1 BrdU for 2 h. For quantification, the number of BrdU-positive cells was determined as the average count of 3 random fields of view. Images were obtained using a fluorescence microscope (Olympus).

Migration assay

HUVECs (30 000 cells per well) or FLSs (50 000 cells per well) were suspended in high glucose Dulbecco’s modified Eagle’s medium (DMEM) without fetal bovine serum (FBS) (Gibco, Gaithersburg, MD, USA), and 200 µL of this cell suspension was seeded into Transwell inserts (PC member, 6.5 mm diameter, 8 µm pores; Corning #3422). The inserts were placed in a 24-well plate containing 800 µL of DMEM with 10% FBS. The cells that migrated to the lower side of the Transwell insert were fixed in methanol and stained with 2% crystal violet. After being washed extensively with PBS to remove any excess crystal violet stain, the number of cells that had migrated was counted in three different representative high‐power fields per insert with an inverted microscope (Olympus).

Invasion assay

HUVECs (150 000 cells per well) or FLSs (200 000 cells per well) were suspended in high glucose DMEM without FBS (Gibco), and 200 µL of this cell suspension was seeded into Transwell inserts (PC member, 6.5 mm diameter, 8 µm pores; Corning #3422; Corning, Sunnyvale, CA, USA). The inserts were coated with 16% Matrigel (356231; BD Biosciences, San Diego, CA, USA) in DMEM without FBS. After 5 h, the inserts were placed in a 24-well plate containing 800 µL of DMEM containing 20% FBS. The cells that migrated to the lower side of the Transwell insert were fixed in methanol and stained with 2% crystal violet. After being washed extensively in PBS to remove excess crystal violet stain, the number of cells that had migrated was counted in three different representative high-power fields per insert using an inverted microscope (Olympus).

Scratch assay

HUVECs or FLSs were seeded in six-well plates and grown to confluence. A scratch wound was made in each well using a sterile pipette tip. The cells were subsequently exposed to DMEM containing 10% FBS for 12 h, 24 h, or 36 h. HUVEC or FLS migration across the wound margins was assessed, photographed, and measured using ImageJ software. The average percentage of wound healing was calculated in three different fields at 12 h, 24 h, or 36 h.

Flow cytometry

After being treated with vehicle, LPS, IL4, FABP4 or BMS309403, BMDMs were harvested and washed twice with cold PBS. For cell-surface analysis, the cells were stained with F4/80 (123119, BioLegend), CD11b (101227, BioLegend) and CD86 (105007, BioLegend) at the recommended antibody concentrations at 4 °C for 30 min after being incubated with FcRblock (101319, BioLegend) at 4 °C for 10 min. For CD206 (141707, BioLegend) staining, the cells were fixed and permeabilized before being incubated at 4 °C for 30 min. Cells were analyzed using an LSRFortessa (BD). Data were acquired and processed using Flow Jo software.

Immunohistochemistry and immunofluorescence analysis

Tartrate-resistant acid phosphatase (TRAP) staining (Sigma–Aldrich, Missouri, USA) was performed according to the manufacturer’s instructions. All slides were prepared as described previously.59 After deparaffinization and rehydration, the sections were soaked in citrate buffer (10 mmol·L−1 citric acid, pH 6.0) overnight at 60 °C to unmask the antigen. For immunohistochemical staining, 3% hydrogen peroxide was added and incubated for 10 min to inactivate any endogenous peroxidase activity. The sections were blocked with 1% goat serum at 37 °C for 1 h. FABP4 (1:100 for IHC, Abclone #A0232) and MMP13 (1:100 for IHC, Proteintech #18165-1-AP) primary antibodies were added and incubated overnight at 4 °C. For immunohistochemical staining, the sections were stained with horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA), 3,3′-diamino-benzidine (DAB; ZSGB-Bio, Beijing, China) was used to observe chromogens, and hematoxylin was used as a counterstain. For immunofluorescence analysis, the primary antibodies were against F4/80 (1:100 for IF, Santa Cruz #sc-377009; Santa Cruz Biotechnology, Santa Cruz, CA, USA), NOS2 (1:100 for IF, Santa Cruz #sc-7271), FABP4 (1:100 for IF, Abclone #A0232; ABclone, Woburn, MA, USA), vimentin (1:100 for IF, Santa Cruz #sc-6260), MMP3 (1:100 for IHC, Proteintech #17873-1-AP; Proteintech, Rosemont, IL, USA), CD31 (1:100 for IF, R&D #AF3628; R&D Biosystems, Minneapolis, MN, USA), EMCN (1:100 for IF, Santa Cruz #sc-65495), and Col2a1 (1:100 for IF, Abcam #ab34712). For secondary reactions, the sections were stained with species-matched Alexa 488 or Alexa 594 dye-labeled secondary antibodies (Life Technologies, Carlsbad, CA, USA). Nuclei were labeled with 4,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, Waltham, MA, USA), and images were obtained using a fluorescence microscope (Olympus). Under high magnification, three fields of the medial synovium were selected, and the number of positively stained macrophages in the synovium was calculated to obtain a mean value. The sections were randomly coded, and three sections per joint were scored by two blinded observers.

rmFABP4, BMS309403 and anagliptin treatment

rmFABP4 (#RPB693Mu01, Cloud-Clone Corp., China) (5 μg per 10 μL per week) was intra-articularly injected into C57BL/6 J mice with antigen-induced arthritis once per week for 4 or 8 weeks, while BMS309403 (5 mg·kg−1) was administered twice per week to C57BL/6 J and TSC1KO mice with antigen-induced arthritis via an intraperitoneal injection for 4 or 8 weeks. Anagliptin (0.3%) was administered to TSC1KO mice with antigen-induced arthritis for 4 and 8 weeks. The control groups were treated with saline for an equivalent time.

Western blot analysis

Cells and synovial tissue were immediately lysed for 10 min on ice in lysis buffer (62.5 mmol·L−1 Tris-HCl, pH 6.8, 10% glycerol, 2% sodium dodecyl sulfate, 50 mmol·L−1 dithiothreitol, and 0.01% bromophenol blue) containing phosphatase and protease inhibitors. Cell lysates were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane (Bio–Rad Corp., Hercules, CA, USA). The blots were probed with primary antibodies, and immunoreactive proteins were revealed using an enhanced chemiluminescence kit (Santa Cruz Biotechnology Inc.).

ELISA

We used human and mouse FABP4 ELISA kits (Elabscience Biotechnology, Bethesda, MD, USA: #E-EL-H0285c and #E-EL-M2404c) to analyze the level of FABP4 in the supernatant of macrophages stimulated with lipopolysaccharide (LPS), the serum of C57BL/6 J and TSC1KO mice, and human serum and synovial fluid. ELISA was performed according to the manufacturer’s instructions.

Statistical analysis

All experiments were performed in duplicate or triplicate and were observed by independent observers. Differences between two groups were analyzed using Student’s t test, while differences between the three groups were analyzed by one-way analysis of variance (ANOVA) and Tukey’s multiple comparison test. All statistical analyses were performed with GraphPad Prism 6.0 (GraphPad Software Inc., La Jolla, CA, USA). The results are presented as the mean ± standard error (SEM), and P < 0.05 was considered to be statistically significant.