Abstract

Myelodysplastic/myeloproliferative neoplasm, unclassifiable (MDS/MPN-U) is a poorly characterized entity among overlap myeloid syndromes. Recent studies have shown heterogeneous mutational profiles in this group being able to subclassify them into entities closely related to the more well-established disorders under the umbrella term of the MDS/MPN group. Recurrent cytogenetic alterations are, nonetheless, rare in MDS/MPN-U. Here, for the first time, we report a case of MDS/MPN-U with a t(X;17)(q28;q21) chromosomal rearrangement leading to the KANSL1-MTCP1 fusion gene.

© 2022 The Author(s). Published by S. Karger AG, Basel

Established Facts Novel Insights

This is the first case of MDS/MPN with a t(X;17) translocation leading to KANSL1-MTCP1 and KANSL1-CMC4 fusion genes.

As in T-PLL, the overexpression of oncogenic protein MTCP1 might have a pathogenic role in myeloid neoplasms.

Introduction

Myelodysplastic/myeloproliferative neoplasm, unclassifiable (MDS/MPN-U) has morphological features that overlap with both myelodysplastic syndrome (MDS) and myeloproliferative neoplasm (MPN) categories but do not meet the criteria for any specific MDS/MPN [Swerdlow et al., 2017]. It is the most poorly established entity among all subtypes of MDS/MPN overlap syndromes [Arber et al., 2016]. There are no specific molecular genetic findings in MDS/MPN-U. Several studies have described ASXL1, TET2, JAK2, SETBP1, NRAS, EZH2, RUNX1, and CBL mutations in different frequencies [Meggendorfer et al., 2013; Wang et al., 2014; Zoi and Cross, 2015; Bose et al., 2018]. The majority of MDS/MPN syndromes show a normal karyotype, however, recurrent cytogenetic changes are seen more frequently in the MDS/MPN-U when compared to the other MDS/MPN entities, with trisomy 8 and del(7q) being the most common changes identified [Bose et al., 2018]. Recently, a novel t(X;17)(q28;q21) chromosomal rearrangement was described in a case of acute monocytic leukemia resulting in KANSL1-MTCP1 and KANSL1-CMC4 fusion genes [Li et al., 2020]. Herein, we describe, to the best of our knowledge, the first case of MDS/MPN-U with a t(X;17)(q28;q21) chromosomal rearrangement.

Case Presentation

An asymptomatic 42-year-old man was found to have an abnormal complete blood count during his annual family physician visit. Blood tests indicated hemoglobin of 115 g/L, leukocytes of 34 × 109/L, platelet count of 400 × 109/L, absolute neutrophil count of 22.7 × 109/L, and absolute monocyte count of 5.7 × 109/L. Rare circulating blast cells were present. CT scan showed a mildly enlarged spleen of 15 cm but no lymphadenopathy or hepatomegaly. Bone marrow evaluation showed MDS/MPN-U with 12% blast cells of myeloid phenotype expressing CD13, CD33, CD34, CD117, and HLA-DR but not CD11b, CD14, CD35, and CD300e. Trilineage dysplasia was observed with a mild increase in mature monocytes. The G-banded karyotype showed a balanced translocation involving chromosomes X and 17 in 16 of 20 metaphases (Fig. 1a). The breakpoints of Xq28 and 17q21 are not recognized as breakpoints involved in a frequent recurrent rearrangement in myeloid neoplasia. However, a literature search suggested a rare t(X;17) that fuses the KANSL1 gene with both MTCP1 and CMC4 genes in a case of acute myeloid leukemia [Li et al., 2020]. The MTCP1 and CMC4 genes overlap and share several exons. Since commercial fluorescence in situ hybridization (FISH) probes were unavailable, custom-labeled BACs were ordered (Centre for Applied Genomics, Toronto, Canada). The MTCP1 locus on Xq28 (orange label) was represented by BAC probe RP11-402H20, and the KANSL1 locus on 17q21 (green label) was represented by RP11-904E20 and RP11-669E14. FISH was performed on metaphases that had previously been analyzed by karyotyping and shown to carry the t(X;17). Sequential G-banding-to-FISH showed a co-localization of the MTCP1 and KANSL1 probes on both derivative chromosomes, der(X) and der(17), indicating a rearrangement involving these gene regions (Fig. 1b). Seven abnormal metaphases were analyzed that showed fusion of the KANSL1 and MTCP1/CMC4 probes. The remaining normal metaphase did not show a fusion of the KANSL1 or MTCP1/CMC4 probes. An interphase FISH analysis was not performed.

Fig. 1.

a G-banded karyogram illustrating the t(X;17)(q28;q21). Red arrows indicate the breakpoints of the rearrangement on chromosomes X and 17. b Sequential G-banding-to-FISH (inverted DAPI) performed on previously karyotyped metaphases shows the co-localization of the RP11-402H20 (MTCP1/CMC4 region, orange) and RP11-904E20/RP11-669E14 probes (KANSL1 region, green) on the derivative X and derivative 17 chromosomes indicating a translocation (red and green probe fusion signals). The normal chromosome 17 shows only the green signal of the KANSL1 probe. c Optical genome mapping (OGM) circos plot also showing a reciprocal translocation between chromosomes X and 17 represented by the pink line in the centre of the plot (red arrow). d OGM detailed genome view shows a hybrid molecule (blue bar) aligning to the chromosome 17 reference (green bar, top) and the chromosome X reference (green bar, bottom). The breakpoint is estimated in the exon 1–2 region of KANSL1 and in the 5′ region of the MTCP1 and CMC4 genes. Direction of transcription of each gene is indicated by a text arrow beside the gene name. e RT-PCR using published primers [Li et al., 2020] for the KANSL1-MTCP1 and KANSL1-CMC4 fusions. PCR in the left lane (no template control) does not produce a product, neither do the primers with control RNA (second lane). The K4F, M3R primers produce a faint 233-bp band (third lane), and the K4F, C4R primers show a strong fusion product at 366 bp (fourth lane) at an annealing temperature of 59°C. PCR primers and conditions were performed as outlined in Li et al. [2020]. K4F - GGGCTACGCTCCTCCATCA (KANSL1 NM_001193465.1), M3R - CACATCCTCTCCTGCCATTCT (MTCP1 NM_001018025.4), and C4R - ACTGAGCACAACACTTACG (CMC4 NM_001018024.3).

Further, we performed Optical Genome Mapping (OGM, Bionano Genomic Saphyr), showing a balanced translocation between chromosomes X and 17 (Fig. 1c). Since OGM has a higher resolution than either karyotyping or FISH, it demonstrated that the translocation breakpoints are, in fact, within the KANSL1 and MTCP1/CMC4 genes (Fig. 1d). RT-PCR was also performed to confirm the presence of a chimeric fusion protein between KANSL1 and MTCP1/CMC4 (Fig. 1e).

Next-generation sequencing, examining DNA sequence variants in the exonic coding regions of 49 clinically relevant genes in hematological malignancies, showed the presence of the JAK2 V617F (variant allele frequency [VAF], 16%), SETBP1 (VAF, 27%), U2AF1 (VAF, 41%), and 2 variants of uncertain significance in CTNNA1 (VAF, 51%) and TP53 (VAF, 52%). The TP53 variant (p.Arg290Cys) had been previously reported in hematological malignancies and affected the DNA-binding domain of the gene. However, functional studies have shown that this variant preserves transactivation activity equivalent to the normal p53 protein and is not expected to disrupt the transcriptional activity of the encoded protein (IARC TP53 database; p53.iarc.fr); it was, therefore, classified as a variant of uncertain significance [Petitjean et al., 2007].

The therapeutic plan for this patient was a fully matched allogeneic bone marrow transplant, so he was started on azacytidine to control the disease. His sister was found to be HLA identical. While the transplant was delayed due to COVID pandemic, several follow-up bone marrow aspirates and biopsies were performed, all consistent with persistent disease showing between 6 and 13% blasts and moderate control of peripheral blood counts. Of note, the patient never had a sustained absolute peripheral monocytosis. He ultimately underwent a fully matched allogeneic bone marrow transplant from his sibling. His most recent bone marrow (day +60) did not show any evidence of disease.

Discussion

MDS/MPN-U is associated with a median overall survival of approximately 12–21 months [DiNardo et al., 2014; Wang et al., 2014]. Of all the MDS/MPNs, the genomic profile of MDS/MPN-U is the least well characterized, which is unsurprising given that its diagnosis is predicated on the failure to meet criteria for any other specific MDS/MPN. Recent studies, however, have shed some more light on this area [Wan and Han, 2020]. Palomo et al. [2020] performed mutational analyses on the largest well-annotated MDS/MPN cohort to date, a total of 367 patients, of which 106 had MDS/MPN-U. The combination of 2 frequently mutated genes, SETBP1 (as an ancestral mutation) and JAK2 (as a secondary mutation), is most commonly seen in MDS/MPN-U, among other subgroups [Palomo et al., 2020]. They utilized molecular signatures identified in the other MDS/MPNs to subclassify these cases as CMML-like, aCML-like, MDS/MPN-RS-T-like, as well as a TP53 mutated and an “Other” group. Our case showed mutations in JAK2 V617F, U2AF1, TP53, and SETBP1. However, the mutational profile of our case does not match any of their more well-characterized groups, although the presence of U2AF1 and JAK2 in conjunction with thrombocytosis was more in keeping with the “Other” group [Palomo et al., 2020].

To our knowledge, this is the first case to show a t(X;17)(q28;q21) resulting in KANSL1-MTCP1 and KANSL1-CMC4 fusion genes in an MDS/MPN. Little is published in the medical literature concerning MTCP1/CMC4 and myeloid neoplasms. A recent paper by Li et al. [2020] has helped characterize the role of the t(X;17)(q28;q21) KANSL1-MTCP1 gene fusion in a case of acute myeloid leukemia, and more specifically, elucidated the function of MTCP1 in myeloid neoplasia. MTCP1 is not expressed under physiological conditions, but aberrant expression causes increased cell proliferation and a partial block in differentiation. A t(X;17)(q28;q21) has also been reported as the sole karyotypic anomaly in what was described as a morphological subtype of acute promyelocytic leukemia, which did not demonstrate a PML-RARα rearrangement by FISH, suggesting, in our opinion, that MTCP1 (located in Xq28) may have played a role in its pathogenesis although this is somewhat speculative [Wang et al., 2010].

MTCP1 has been studied more extensively in the context of T-cell prolymphocytic leukemia (T-PLL) [Madani et al., 1996; Gritti et al., 1998; De Schouwer et al., 2000]. In this context, MTCP1 has been shown to be a 3D structural analog of TCL1 [Petock et al., 2002]. The mechanism involved in T-PLL, however, involves placing MTCP1 under the control of regulatory sequences of a T-cell receptor gene resulting in increased MTCP1 expression, as opposed to forming a fusion protein. Members of the TCL1 proto-oncogene family (TCL1, MTCP1, and TCL1b) are known to bind to Akt1, increasing its phosphorylation status and kinase activity and allowing enhanced signal transduction, cell proliferation, and survival [Laine et al., 2002; Sun and Fang, 2020]. While not completely elucidated, it appears that the presence of TCL1 translocation or protein expression is associated with poor outcomes in T-PLL [Jain et al., 2017]. If the presence of an MTCP1 translocation portends a better prognosis is not fully understood.

MDS/MPN-U remains a poorly defined MDS/MPN subcategory in the WHO classification of hematopoietic tumors despite some recent progress in our understanding of its molecular landscape [Palomo et al., 2020; Wan and Han, 2020]. Lack of ASXL1 and presence of JAK2 are shown to be associated with better prognosis in MDS/MPN overlap syndromes [Cannella et al., 2008; Patnaik et al., 2014; Cui et al., 2015]. The effect of MTCP1 expression in the prognosis of myeloid neoplasm is not known. Our patient was in complete remission at the latest follow-up, about 1 year from diagnosis. Our discovery of a t(X;17)(q28;21) KANSL1-MTCP1/CMC4 gene fusion, a novel finding in the case of MDS/MPN-U, further enhances our knowledge of the underlying potential genetic drivers of this diverse entity as well as provides an additional example of this extremely rare gene fusion in the context of myeloid neoplasia.

Acknowledgment

The authors would like to thank the members of the Cancer Cytogenetics Laboratory at the University Health Network, and especially acknowledge the technical expertise of Ms. Cherry Have for custom FISH probe analysis.

Statement of Ethics

As a case report, the study was granted an exemption from requiring ethics approval from the “Research Ethics Board” of the University Health Network. The study was conducted in compliance with the Declaration of Helsinki. Informed written consent was obtained from the patient to publish the details of medical conditions and treatment regimens.

Conflict of Interest Statement

The authors have no conflicts of interest to declare.

Funding Sources

The authors have no funding sources to declare.

Author Contributions

A.S.: study design, acquisition, assembly, analysis and interpretation of data, drafting of the manuscript, critical revision of the manuscript for important intellectual content. P.M.: study design, analysis, and interpretation of data, drafting of the manuscript. A.C.S.: study design, acquisition and interpretation of cytogenetic data, drafting of the manuscript, critical revision of the manuscript for important intellectual content. S.S.: acquisition, analysis, and interpretation of molecular data, drafting of the manuscript, critical revision of the manuscript for important intellectual content.

Data Availability Statement

All data generated or analyzed during this study are included in this article. Further inquiries can be directed to the corresponding author.

References Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood. 2016;127(20):2391–405. Bose P, Nazha A, Komrokji RS, Patel KP, Pierce SA, Al-Ali N, et al. Mutational landscape of myelodysplastic/myeloproliferative neoplasm-unclassifiable. Blood. 2018;132(19):2100–3. Cannella L, Breccia M, Latagliata R, Frustaci A, Alimena G. Clinical and prognostic features of patients with myelodysplastic/myeloproliferative syndrome categorized as unclassified (MDS/MPD-U) by WHO classification. Leuk Res. 2008;32(3):514–6. Cui Y, Tong H, Du X, Li B, Gale RP, Qin T, et al. Impact of TET2, SRSF2, ASXL1 and SETBP1 mutations on survival of patients with chronic myelomonocytic leukemia. Exp Hematol Oncol. 2015;4:14. De Schouwer PJ, Dyer MJ, Brito-Babapulle VB, Matutes E, Catovsky D, Yuille MR. T-cell prolymphocytic leukaemia: antigen receptor gene rearrangement and a novel mode of MTCP1 B1 activation. Br J Haematol. 2000;110(4):831–8. DiNardo CD, Daver N, Jain N, Pemmaraju N, Bueso-Ramos C, Yin CC, et al. Myelodysplastic/myeloproliferative neoplasms, unclassifiable (MDS/MPN, U): natural history and clinical outcome by treatment strategy. Leukemia. 2014;28(4):958–61. Gritti C, Dastot H, Soulier J, Janin A, Daniel MT, Madani A, et al. Transgenic mice for MTCP1 develop T-cell prolymphocytic leukemia. Blood. 1998;92(2):368–73. Jain P, Aoki E, Keating M, Wierda WG, O'Brien S, Gonzalez GN, et al. Characteristics, outcomes, prognostic factors and treatment of patients with T-cell prolymphocytic leukemia (T-PLL). Ann Oncol. 2017;28(7):1554–9. Laine J, Künstle G, Obata T, Noguchi M. Differential regulation of Akt kinase isoforms by the members of the TCL1 oncogene family. J Biol Chem. 2002;277(5):3743–51. Li SX, Chen XJ, Jiang L, Lei YC, Zhang YX, Dai B, et al. Identification of a t(X;17)(q28;q21) generating a KANSL1-MTCP1 gene fusion leading to dysregulated expression of MTCP1 in acute myeloid leukemia. Genes Chromosomes Cancer. 2020;59(7):417–21. Madani A, Choukroun V, Soulier J, Cacheux V, Claisse JF, Valensi F, et al. Expression of p13MTCP1 is restricted to mature T-cell proliferations with t(X;14) translocations. Blood. 1996;87(5):1923–7. Meggendorfer M, Bacher U, Alpermann T, Haferlach C, Kern W, Gambacorti-Passerini C, et al. SETBP1 mutations occur in 9% of MDS/MPN and in 4% of MPN cases and are strongly associated with atypical CML, monosomy 7, isochromosome i(17)(q10), ASXL1 and CBL mutations. Leukemia. 2013;27(9):1852–60. Palomo L, Meggendorfer M, Hutter S, Twardziok S, Ademà V, Fuhrmann I, et al. Molecular landscape and clonal architecture of adult myelodysplastic/myeloproliferative neoplasms. Blood. 2020;136(16):1851–62. Patnaik MM, Itzykson R, Lasho TL, Kosmider O, Finke CM, Hanson CA, et al. ASXL1 and SETBP1 mutations and their prognostic contribution in chronic myelomonocytic leukemia: a two-center study of 466 patients. Leukemia. 2014;28(11):2206–12. Petitjean A, Mathe E, Kato S, Ishioka C, Tavtigian SV, Hainaut P, et al. Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 database. Hum Mutat. 2007;28(6):622–9. Petock JM, Torshin IY, Wang YF, Du Bois GC, Croce CM, Harrison RW, et al. Crystal structures of Tcl1 family oncoproteins and their conserved surface features. ScientificWorldJournal. 2002;2:1876–84. Sun S, Fang W. Current understandings on T-cell prolymphocytic leukemia and its association with TCL1 proto-oncogene. Biomed Pharmacother. 2020;126:110107. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, et al. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Revised 4th ed. IARC; 2017. Wan Z, Han B. Comparison and Implications of Mutational Profiles of Myelodysplastic Syndromes, Myeloproliferative Neoplasms, and Myelodysplastic/Myeloproliferative Neoplasms: A Meta-Analysis. Front Oncol. 2020;10:579221. Wang HP, Xu H, Chen ZM, Tong XM, Qian WB, Jin J. t(X;17) as the sole karyotypic anomaly in a case of M(3r) subtype of acute promyelocytic leukemia without RARalpha rearrangement. Leuk Res. 2010;34(2):e55–7. Wang SA, Hasserjian RP, Fox PS, Rogers HJ, Geyer JT, Chabot-Richards D, et al. Atypical chronic myeloid leukemia is clinically distinct from unclassifiable myelodysplastic/myeloproliferative neoplasms. Blood. 2014;123(17):2645–51. Zoi K, Cross NC. Molecular pathogenesis of atypical CML, CMML and MDS/MPN-unclassifiable. Int J Hematol. 2015;101(3):229–42. Author Contacts

Ali Sakhdari, asakhdari@gmail.com

Article / Publication Details

First-Page Preview

Received: May 19, 2021
Accepted: December 12, 2021
Published online: January 17, 2022

Number of Print Pages: 5
Number of Figures: 1
Number of Tables: 0

ISSN: 1424-8581 (Print)
eISSN: 1424-859X (Online)

For additional information: https://www.karger.com/CGR

Open Access License / Drug Dosage / Disclaimer

This article is licensed under the Creative Commons Attribution 4.0 International License (CC BY). Usage, derivative works and distribution are permitted provided that proper credit is given to the author and the original publisher.Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug. Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.