Cell culture

The PDLCs were purchased from ScienCell Research Laboratories (ScienCell, #2630). Cell culture and inflammatory stimulation have been described as previous study.40 PDLCs were cultured in DMEM containing 10% FBS and 1% penicillin/streptomycin. PDLCs between passages 2 and 5 were used for subsequent experiments. 10 ng/mL TNF-α and 5 ng/mL IL-1β was added to the culture medium to simulate inflammatory stimulation.

CCK-8 assay

PDLCs were inoculated in 96-well plates and incubated with different doses of Sin for 24 h. Then, 20 μL of CCK-8 antibody-blocking peptide (Bioss) was added to each well. The plate was then placed in an incubator for 4 h. Finally, the absorbance at 450 nm was measured using a microplate reader. Cell viability was calculated based on the absorbance value of each well.

SOD, MDA, and GSH assay

PDLCs were seeded in 6-well plates and cells were collected separately 24 h later. After cells resuspended in PBS containing PMSF, ultrasonic disruption was performed using an ultrasonic disruptor. Cells were sonicated and quantified using the BCA Protein Detection Kit. Superoxide dismutase (SOD) detection kit (WST-1 method; Nanjing Jiancheng Bioengineering Co., Ltd.), cell malondialdehyde (MDA) detection kit (colorimetry; Nanjing Jiancheng Bioengineering Co., Ltd.) and the Reduced Glutathione (GSH) Assay Kit (Microplate method; Nanjing Jiancheng Bioengineering Co., Ltd.) were used to measure SOD activity, MDA and GSH levels in PDLCs according to the manufacturer’s instructions. Antioxidants and oxidation products were estimated to explore the effect of Sin on cellular redox responses.41

ROS detection

The intracellular ROS levels in PDLCs from different groups were determined using a Reactive Oxygen Species Assay Kit (Beyotime). The fluorescent probe DCFH-DA diluted with serum-free medium was added to the medium at a final concentration of 10 μmol/L. The cells were incubated for 20 min at 37 °C and washed twice with PBS. The cells were harvested, resuspended in serum-free medium, and transferred into flow tubes for centrifugation and washing. Finally, cell suspension samples were detected by flow cytometry to analyze the percentage of ROS-positive cells.

Lentivirus transfection

The lentiviral vectors containing shRNA targeting Bach1 and overexpression of Bach1 were purchased from GeneChem. Co. (Shanghai, China). The lentiviral vector and transfection procedure have been described as the previous study.39

Cellular thermal shift assay

PDLCs were inoculated in 100 mm dishes and cultured to 90% confluency. Cells were then treated with 10 μmol/L Sin or an equal volume of DMSO for 2 h. Cells were harvested and washed twice with PBS. 500 μL PBS (containing PMSF) was added to resuspend the cells, and they were immersed in liquid nitrogen and freeze-thawed 3 times. Centrifugation at 12 000 g for 10 minutes was then performed to remove the pellet. The supernatant was divided into 9 PCR tubes, each containing 20 μL, and placed in a PCR machine to receive different temperature stimuli for thermal denaturation. Centrifugation at 20 000×g for 20 min was then performed to remove the precipitate, and the supernatant was analysed by western blotting.

Molecular docking

The molecular structure of Sin was depicted by ChemOffice and then opened in Discovery Studio (DS) to optimize the compound structure. The crystal structure of Bach1 was downloaded from the PDB database and optimized using DS. Based on the protein structure, precise molecular docking with Sin was carried out. The corresponding three-dimensional and two-dimensional interaction images were generated, and the interaction energy was sorted and analyzed.

Western blotting

Total proteins were extracted using RIPA buffer containing 1 mmol/L PMSF. The proteins were separated by electrophoresis on the SDS-PAGE gel and transferred to PVDF membrane (Millipore). The membrane was blocked in 5% BSA buffer for 1 h at room temperature and then incubated overnight at 4 °C with the following primary antibodies: anti-Bach1 (1:1 000, Proteintech), anti-HO-1 (1:1 000, Proteintech), anti-GPX4 (1:1 000, CST), anti-β-tublin (1:3 000, Proteintech), and anti-β-actin (1:2 000, Affinity Biosciences). Finally, the target protein bands were visualized using ECL luminescence reagents (NCM Biotech) and the imaging system (Bio-Rad ChemiDocTM XRS + ).

Immunofluorescence staining

PDLCs were cultured in 24-well plates, and after the cells adhered to the wells, cells were incubated with different stimulus conditions for 24 h. Then we aspirated the medium and gently shook the cells with PBS buffer. Cells are fixed in 1% paraformaldehyde for 30 min and permeabilized in PBS with 0.1% Triton X-100 for 20 min at room temperature. Then cells were incubated with 3% goat serum for 1 h to block non-specific binding sites. Fixed cells are incubated overnight with primary antibodies against Bach1 (1:200, Proteintech) at 4 °C, followed by 1 h at room temperature with fluorescent (FITC)-conjugated goat anti-rabbit IgG (1:1 000, Thermo Fisher Scientific). Nuclei were stained with DAPI for 15 min. All samples were imaged with Laser confocal scanning microscope (Leica TCS SP8-MP). Image J Software (NIH) was used to calculate the ratio of positive expression area to total fields of Bach1.

Quantitative real-time polymerase chain reaction

Total RNA was isolated from PDLCs and reverse-transcribed into cDNA, followed by quantitative PCR using the BioRad CFX96 Real-Time PCR Detection System (BioRad), and threshold cycle numbers were obtained using BioRad CFX manager software. The cycling program was 1 cycle of 95 °C for 2 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The primer sequences used in this study were as follows: IL-6 forward: ACTCACCTCTTCAGAACGAATTG, reverse: CCATCTTTGGAAGGTTCAGGTTG; IL-10 forward: GACTTTAAGGGTTACCTGGGTTG, reverse: TCACATGCGCCTTGATGTCTG. The relative amount of the IL6 or IL10 gene was normalized by the amount of β-actin and then reported as a fold change at the basal level.

Chromatin immunoprecipitation-quantitative polymerase chain reaction

DNA and proteins in cells were cross-linked using 1% formaldehyde solution under physiological conditions. Chromatin was broken down by ultrasound treatment, and anti-Bach1 antibody or IgG antibody was added to precipitate the cross-linked complex. Precipitate of DNA fragments binding to Bach1 or IgG was then collected. De-crosslinking was performed, proteins were removed with proteases treatment, and DNA fragments were purified. DNA sequences specifically binding to Bach1 or IgG were screened by qRT-PCR. The primer sequences used are HMOX1 promoter forward: TCACAGTATTGGGAAAGGACTG, reverse: GTGGACTCCTTAGAACTCGGG; Gapdh promoter forward: CACAGTCCAGTCCTGGGAAC, reverse: TAGTAGCCGGGCCCTACTTT. During data analysis, the IgG binding amount was subtracted from the Bach1 binding amount to obtain the relative amount.

Co-immunoprecipitation

PDLCs were collected and lysed to extract total protein. A small portion of the harvested cell lysate was used for western blotting, and the remainder was incubated overnight with 4 μg Bach1 antibody at 4 °C and precipitated with protein A/G magnetic beads (Thermo Fisher Scientific) for 1 hour at room temperature. The magnetic beads were washed four times with washing buffer (PBS buffer containing 0.05% Tween 20) on a magnetic scaffold. The immunoprecipitated protein was then boiled in loading buffer for 10 min. Finally, immunoprecipitated proteins were detected by western blotting.

Experimental periodontitis model in vivo

The animal experiment protocol was reviewed and approved by the Laboratory Animal Welfare and Ethical Review of Nanjing University (No: IACUC-2003053). The animal feeding procedures and the establishment of experimental periodontitis models followed methods that have been described as our previous publications. In brief, 7-week-old male SD rats were housed in an SPF environment and adaptively fed for one week. A total of 15 rats were randomly divided into five groups:

Control group (Ctrl),

Periodontitis group (PD),

Periodontitis group treated with 5 mg/kg per day Sin (Sin-5),

Periodontitis group treated with 10 mg/kg per day Sin (Sin-10),

Periodontitis group treated with 20 mg/kg per day Sin (Sin-20).

The periodontitis model was established by ligating 4-0 silk sutures around the bilateral maxillary second molar for three weeks. Sin was dissolved in CMC-Na and administered to rats by oral gavage. After 3 weeks, all rats were sacrificed by overdose with anesthetics, and the bilateral maxillae were fixed with 4% paraformaldehyde for 48 h.

Micro-CT and histological analysis

To evaluate the loss of the periodontal alveolar bone, the maxillae containing the ligation areas were scanned using micro-CT. Additionally, to estimate the alveolar bone loss, we measured the distance from the cementoenamel junction (CEJ) to the alveolar crest at six different points. The average value of all measurements was recorded as the final alveolar bone loss.

After the Micro-CT analysis, the maxillae samples were decalcified and then embedded in paraffin. The paraffin blocks were sliced to produce 4 μm thin sections, which were then stained with hematoxylin and eosin (H&E). Immunohistochemistry analysis was conducted using anti-TNF-α (GB11188, Servicebio), anti-IL-1β (GB11113, Servicebio), anti-IL-6 (GB11117, Servicebio), anti-IL-10 (GB12108, Servicebio), anti-Bach1 (BS72938, Bioworld), and anti-HO-1(10701-1-AP, Proteintech) antibodies, and the results of staining were quantified using ImageJ software.

Statistical analysis

GraphPad Prism 8.0 was used to analyze the experimental data, and the experimental results were expressed as the mean ± standard deviation. Independent sample t-test was used to compare the differences between the two groups, and one-way analysis of variance was used to compare the differences between multiple groups. When the P value < 0.05, a significant difference was considered.